youblisher.com-683392-manual de participante cedula a

Download Youblisher.com-683392-Manual de Participante Cedula A

Post on 21-Oct-2015

35 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CCCC

    CCCCGGGGCTCTCTCTTTTT1

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    INTRODUCCION

    Se denomina Agentes de Seguros de Vida al que ha preparado para hacer dela venta de seguros una profesin. Si estuviramos en posibilidades de realizarun estudio, descubriramos que es fabulosa la cantidad de agentes de segurosque se adjudican este ttulo an careciendo de los conocimientos mselementales del seguro.

    La personalidad profesional de un individuo se desarrolla en dos etapas: La primera consiste en la adquisicin de conocimientos La segunda en la aplicacin de esos conocimientos, transformados omodificados despus de su contacto con lo que es esencial en cada hombre.

    CCCC

    CCCCGGGGCTCTCTCTTTTT2

    En virtud de los cambios que hoy enfrentamos en el sector asegurador enmateria de capacitacin, nuestro equipo se ha dado a la tarea de establecer unaestrategia cuyo objetivo fundamental es brindar o fortalecer sus conocimientostcnicos, jurdicos, operativos relacionados con las operaciones de vida, daosy accidentes personales, que le facilite acreditar su capacidad tcnica a travsde la sustentacin del examen ante la Comisin Nacional de Seguros y deFianzas, para la obtencin o refrendo de la cdula tipo A, ante la ComisinNacional de Seguros y de Fianzas.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CONTENIDOASPECTOS GENERALES

    I.MARCO JURIDICO............................................................................................... 5

    I.1 LEY GENERAL DE INSTITUCIONES Y SOCIEDADES MUTUALISTAS ............................................... 8 DE SEGUROS

    I.2 LEY SOBRE EL CONTRATO DE SEGUROS .......................................................................................... 28I.3 REGLAMENTO DE AGENTES DE SEGUROS Y DE FIANZAS................................................................ 41I.4 LEY DE PROTECCIN Y DEFENSA AL USUARIO DE

    SERVICIOS FINANCIEROS...................................................................................................................... 45I.5 OPERACIN PARA LA PREVENCIN Y DETECCIN DE

    OPERACIONES DE PROCEDENCIA ILICITA......................................................................................... 49I.6 SISTEMA FINANCIERO MEXICANO ..................................................................................................... . 53I.6.1 LAS INSTITUCIONES QUE OPERAN EN EL SISTEMA FINANCIERO, SU PRPSITO Y RELACION

    ENTRE S ..................................................................................................................................................54I.6.2 TIPOS DE INTERMEDIARIOS FINANCIEROS Y LAS DIFERENCIAS ENTRE ELLOS..........................55I.6.3 RELACION ENTRE LAS AUTORIDADES, INSTITUCIONES E INTERMEDIARIOS DEL SISTEMA

    FINANCIERO .......................................................................................................................................... 55

    CONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICO

    CCCC

    CCCCGGGGCTCTCTCTTTTT3

    FINANCIERO .......................................................................................................................................... 55I.6.4 SECTOR DE ORGANIZACIONES Y ACTIVIDADES AUXILIARES DE CRDITO.................................. 56I.6.5 SECTOR BURSATIL................................................................................................................................ 57I.6.6 SEGUROS Y FIANZAS........................................................................................................................... 58I.6.7 SISTEMAS DE AHORRO PARA EL RETIRO .........................................................................................581.6.8 SISTEMAS DE APOYO...........................................................................................................................59I.6.9 TERMINOLOGA BSICA....................................................................................................................... 60I.6.10 RELACION CON LOS SEGUROS QUE CONTEMPLAN INVERSIN................................................... 66

    II.ASPECTOS TCNICOS....................................................................................... 80II.1 RIESGO.....................................................................................................................................................83II.2 COSTO DEL SEGURO.............................................................................................................................. 87II.3 SINIESTRO.................................................................................................................................................93

    III ASPECTOS OPERATIVOS................................................................................. 74

    III.1 DEL AGENTE............................................................................................................................................97III.2 DE LA ASEGURADORA...........................................................................................................................99III.3 ANTE LAS AUTORIDADES......................................................................................................................103

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CONTENIDO

    RIESGOS INDIVIDUALES DEL SEGURO DE PERSONAS

    IV. VIDA INDIVIDUAL.............................................................................................107

    IV.1 BASES TECNICAS....................................................................................................................................108IV.2 CONDICIONES GENERALES DE LA POLIZA..........................................................................................115IV.3 TIPOS DE PLANES....................................................................................................................................118IV.4 BENEFICIOS Y CLAUSULAS ADICIONALES........................................................................................... 121

    V. ACCIDENTES Y ENFERMEDADES................................................................ 129

    V.1 ACCIDENTES PERSONALES.................................................................................................................... 131V.2 GASTOS MEDICOS MAYORES................................................................................................................. 134V.3 SALUD......................................................................................................................................................... 141

    RIESGOS INDIVIDUALES DEL SEGURO DE DAOS

    CONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICO

    CCCC

    CCCCGGGGCTCTCTCTTTTT4

    V. AUTOMOVILES................................................................................................. 146

    V.1 CONCEPTOS BASICOS........................................................................................................................... 147V.2 ESTRUCTURA DE LA POLIZA................................................................................................................. 150V.3 SINIESTROS............................................................................................................................................ 156

    VI. POLIZA HOGAR ............................................................................................. 160

    VI.1 CONCEPTOS BASICOS............................................................................................................................ 161VI.2 ESTRUCTURA DE LA POLIZA..................................................................................................................162VI.3 SINIESTROS..............................................................................................................................................175

    VII. EMBARCACIONES MENORES DE PLACER ............................................. 177

    VII.1 CONCEPTOS BASICOS.......................................................................................................................... 178VII.2 ESTRUCTURA DE LA POLIZA.................................................................................................................181VII.3 SINIESTROS.............................................................................................................................................183

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CCCC

    CCCCGGGGCTCTCTCTTTTT5

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.1 INTRODUCCIONAUTORIDADES Y DISPOSICIONES LEGALES

    Desde sus inicios, hasta nuestros das, elhombre ha evolucionado y revolucionadosu entorno social; ha sido capaz demodificar su universo y dimensionar supropia existencia.El hombre se ha dado cuenta de que lanecesidad de seguridad es inherente,desde su origen, a l mismo y siente, porsus propias limitaciones, menester desalvaguardarse frente al medio en que sedesenvuelve.Esta necesidad de proteccin la haceextensiva a los suyos, su familia, sucomunidad y su pas. Se proteger ensu persona y en sus bienes contra lasconsecuencias econmicas daosas porlas posibles prdidas que le produzcanlos riesgos que le rodean y amenazan.As, a travs de diferentes caminos, vabuscando la suplencia de laincertidumbre, de lo desconocido. Este

    NECESIDAD DE SEGURIDAD

    DE SU PERSONA

    DE SU FAMILIA

    DE SUS COSAS

    ACTIVIDAD ASEGURADORA

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT6