grado en biotecnologÍa departamento de producciÓn...

UNIVERSIDAD POLITÉCNICA DE MADRID

ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA

AGRONÓMICA, ALIMENTARIA Y DE BIOSISTEMAS

GRADO EN BIOTECNOLOGÍA

DEPARTAMENTO DE PRODUCCIÓN AGRARIA

Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity

TRABAJO FIN DE GRADO

Autor: Ainhoa García Terrón

Co-Tutor Profesional: Etienne Mouisel Co-Tutor UPM: David Menoyo Luque

Julio de 2019

ii

UNIVERSIDAD POLITÉCNICA DE MADRID

ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA

AGRONÓMICA, ALIMENTARIA Y DE BIOSISTEMAS

GRADO EN BIOTECNOLOGÍA

C H A R A C T E R I S A T I O N O F A D I P O S E - S P E C I F I C P A R T I A L D E L E T I O N O F H O R M O N E - S E N S I T I V E L I P A S E D U R I N G

O B E S I T Y

T R A B A J O F I N D E G R A D O

A i n h o a G a r c í a T e r r ó n

M a d r i d , 2 0 1 9

Director: David Menoyo Luque

Profesor Titular de la Universidad

Dpto de Producción Agraria

iii

T Í T U L O D E L T R A B A J O : C H A R A C T E R I S A T I O N O F A D I P O S E -S P E C I F I C P A R T I A L D E L E T I O N O F H O R M O N E - S E N S I T I V E

L I P A S E D U R I N G O B E S I T Y

Memoria presentada por Ainhoa García para la obtención del título de Graduado en

Biotecnología por la Universidad Politécnica de Madrid

Fdo: Alumno

VºBº Tutor y Director del TFG

D. David Menoyo Luque

Profesor Titular de la Universidad

Dpto de Producción Agraria

ETSIAAB - Universidad Politécnica de Madrid

Madrid, 28, Junio, 2019


Ainhoa García Terrón

iv

INDEX

INDEX .............................................................................................................................................iv

FIGURES INDEX .............................................................................................................................. v

ACRONYMS LIST ............................................................................................................................vi

ABSTRACT ..................................................................................................................................... vii

CHAPTER 1. INTRODUCTION ..................................................................................................... 1

CHAPTER 2. MATERIALS & METHODS ....................................................................................... 4

2.1 Animals .......................................................................................................................... 4

2.2 Echo Magnetic Resonance Imaging (EchoMRI) ............................................................. 5

2.3 Insulin (ITT) and Glucose (GTT) Tolerance Tests ........................................................... 5

2.4 Evaluation of gene expression ...................................................................................... 6

2.4.1 RNA extraction ...................................................................................................... 6

2.4.2 Retrotranscription - qPCR...................................................................................... 6

2.5 Protein quantification ................................................................................................... 7

2.5.1 Protein Extraction .................................................................................................. 7

2.5.2 Protein quantification and Western-Blot .............................................................. 7

2.6 Statistics ........................................................................................................................ 7

CHAPTER 3. RESULTS ................................................................................................................. 8

3.1 Model validation: the induction of the HSL deletion is different among the fat depots,

but protein expression has not a direct correlation with gene expression levels. ................... 8

3.2 HSL partial deletion induced during adulthood does not have an effect on

hypercaloric diet-induced weight gain. ..................................................................................... 9

3.3 In chow diet-fed mice, partial deletion of HSL in adulthood entails differences in

tolerance to glucose 6 weeks after induction. .......................................................................... 9

3.4 In vivo tests from weeks 15 and 16 show no significant difference when comparing

HSL partial deletion in adulthood and control groups. ........................................................... 10

CHAPTER 4. DISCUSSION ......................................................................................................... 10

4.1 Model validation – genotype ...................................................................................... 12

4.2 Weigth gain ................................................................................................................. 12

4.3 Tolerance to glucose ................................................................................................... 13

CHAPTER 5. FUTURE PERSPECTIVES ........................................................................................ 15

REFERENCES ................................................................................................................................ 16



v

FIGURES INDEX

Figure 1.1.- FA can be released from the adipocyte by hydrolysis of TAGs thank to the ATGL,

HSL and MGL Intermediate products are Diglycerol (DG) and monoglyceride lipid (MGL). ......... 2

Figure 2.1.- Mice genotype obtaining ........................................................................................... 4

Figure 2.2.- Experiments timeline. 2mgof tamoxifen (AdipoHSL+/-, n=8) or oil (AdipoHSL+/+,

n=7) was injected during 5 days at the age of 14 weeks. Mice were fed under a HFD in week 10

post tamoxifen injection. They were euthanized in week 18. GTT= Glucose tolerance test. ITT=

Insulin tolerance test. .................................................................................................................... 5

Figure 3.1.- Quantification of HSL gene expression in AdipoHSL+/- mice induced with tamoxifen

(black, n = 8) or oil (white, n = 7) in a) iWAt or b)pgWAT. Shown as a percentage of HSL

expression versus the control *** p< 0.0001 ............................................................................... 8

Figure 3.2.- Quantification of iWAT HSL protein expression in mice AdipoHSL+/- with tamoxifen

(black, n = 8) versus control (white, n = 7), normalized according to GAPDH .............................. 9

Figure 3.3.- Measure of a) weight gain and b) % of fat mass gain, expressed as a variation

relative to the weight at time 0 (pre-induction). .......................................................................... 9

Figure 3.4.- Results of the GTT performed at the sixth week. Time 0 = glucose injection.

AdipoHSL mice with tamoxifen (black, n = 8) versus control (white, n = 7). ** p < 0.001 .......... 10

Figure 3.5.- a) Results of the GTT performed at the 15th week. b) Insulin-ELISA on blood from

the 15th week. c) Results of the ITT performed during the 16th week. AdipoHSL mice with

tamoxifen (black, n = 8) versus control (white, n = 7). *** p< 0.0001. ....................................... 11



vi

ACRONYMS LIST

T2D:Type 2 Diabetes

FA: Fatty Acids

IR: Insulin Resistance

HSL: Hormone Sensitive Lipase

WHO: World Health Organization

WAT: White Adipose Tissue

o pgWAT: perigonadal WAT

o iWAT: subcutaneous WAT

TAG: Triacylglycerol

BMI: Body Mass Index

ATGL: Adipocyte Triacylglycerol Lipase

MGL: Monoglyceride Lipase

BAT: brown fat

HFD: High Fat Diet

EchoMRI: Echo Magnetic Resonance Imaging

ITT: Insulin Tolerance Tests

GTT: Glucose Tolerance Tests



vii

ABSTRACT

Obesity is a global pandemic, and the rate of mortality due to associated pathologies,

such as type 2 diabetes (T2D), is increasing every year. One of the most substantiated

causes of obesity-induced T2D concerns the high amount of fatty acids (FA) delivered in

the blood by a hypertrophic adipocyte. FA do not oxidize and therefore are accumulated

in non-adipose organs, leading to insulin resistance (IR) (Large et al. 1998). Therefore,

the study of lipid metabolism- related enzymes becomes increasingly important. Among

them the lipolytic pathway and notably hormone-sensitive lipase (HSL), is the

cornerstone of functional fat cell maintenance (Girousse et al. 2013). We attempted to

advance in the development of a new mouse model characterized by a lipid specific HSL

happloinsufficiency it order to progress in the study of this lipase. We have validated the

model by obtaining mice with nearly half deletion of HSL specific to adipose tissues.

Nevertheless, the tolerance tests results do not show noticeable differences between

control and study group. Such genetic modification do not seem to have systemic

metabolic effects.



1

CHAPTER 1. INTRODUCTION

Obesity and overweight are defined by the WHO as "as an abnormal or excessive

accumulation of fat that can be detrimental to health". Obese people are considered

those who exceed a 30 body mass index or BMI (kg of weight / m2 of height). 13% of

the world population was obese in 2016 (World Health Organization 2018b). In

particular, the prevalence of obesity among adults in Spain is 21,6% (Aranceta-Bartrina

2016). This pathology is a risk factor for the development of other diseases, such as

cardiovascular diseases, insulin resistance, diabetes, diseases of the locomotor system

and some types of cancer(World Health Organization 2018). 85% of type 2 diabetics are

overweight (Fundación para la diabetes n.d.). It is becoming increasingly important and

13,8% of adult Spanish population already suffer from type 2 diabetes (Calle 2011).

White adipose tissue (WAT) is the most affected tissue in obesity. It is mainly formed by

adipocytes, where fatty acids (FA) accumulate in triacylglycerol (TAG) and constitute the

main energy reserve of the body. In addition to adipocytes, the stromal vascular fraction

is part of the tissue, in which there are preadipocytes, stem cells, fibroblasts, endothelial

and immune cells, such as macrophages and lymphocytes (Morigny et al, 2016).

Different WAT pads exist in the body, that differ by their localization (subcutaneous vs

visceral) and their association to metabolic disorder, being visceral fat pad expansion

linked to greater insulin resistance (Castro et al. 2014). The fact that insulin-sensitive

tissues (muscle, liver or fat) do not respond properly to insulin lead to an oversecretion

of insulin by the pancreas permitting a transitory maintain of glycemia that could

become not enough to avoid a chronic hyperglycemia. Chronic hyperglycemia (>1.26 gl-1

measured twice at fasted states) is the definition of the diabetes (Mouri and Badireddy

2019).

One explanation largely described of insulin resistance concerns the high amount of free

FA delivered by obese WAT at the basal state in the blood, (Boden 2011). This excess of

FA is not completely oxidized by tissues that need such substrate, leading to a non-fat

depot that inhibit insulin pathway in those organs.



2

The controlled balance of esterification and lipolysis and high adipocyte plasticity is what

protects the ectopic deposit of fatty acids, preventing the development of diseases

associated with obesity (Morigny et al. 2016).

In addition, a direct relationship has been established between BMI and how a decrease

in lipolysis improves insulin sensitivity (Girousse et al. 2013).

Adipose tissue controls the process of lipid storage in periods of energy excess,

especially in the postprandial period, by esterification of three FA and a glycerol

molecule, obtaining TAGs. It also controls lipolysis when energy is needed (fasting or

physical exercise), hydrolysing TAG. Hydrolysis takes place by the sequential

intervention of three enzymes: the adipocyte triacylglycerol lipase (ATGL), the hormone-

sensitive lipase (HSL) and the monoglyceride lipase (MGL).

HSL is a limiting step of lipolysis due to its strong hydrolase activity (Lafontan and Langin

2009) and is an important factor in the maintenance of adipose tissue in adulthood

(Girousse et al. 2013), which is why it has become interesting to study as a target to

combat type 2 diabetes.

It has been shown that HSL -/- mice develop a resistance to high fat diet-induced obesity

(Harada et al. 2003). Interestingly, in the work published by the laboratory (Girousse et

al. 2013), it was shown that HSL +/- mice did not become less obese than WT mice

following a same hypercaloric diet, nor was their adipose tissue more inflamed.

Nevertheless, overall FA flows were small. This was accompanied by an improvement in

Figure 1.1.- FA can be released from the adipocyte by hydrolysis of TAGs thank to the ATGL, HSL and MGL Intermediate products are Diglycerol (DG) and monoglyceride lipid (MGL).



3

glucose metabolism, both uptake and de novo lipogenesis in insulin-sensitive tissues.

ATGL levels in HSL +/- and WT mice were similar, indicating that there is not any

compensatory mechanism that could explain differences in lipolysis. However, since the

muscle has a high lipolytic activity and an important role in glucose homeostasis, a new

mouse model is being developed: inducing haploinsufficient HSL specifically in adipose

tissue during adulthood.

The aim of this work was to advance the development and characterization of this new

model of adipose tissue specific heterozygosity for the HSL, in a context of diet-induced

obesity.



4

CHAPTER 2. MATERIALS & METHODS

2.1 Animals

All procedures where carried on in agreement to the INSERM and Genotoul Anexplo

animal core facility guidelines for the care and use of laboratory animals, by respecting

the three R rules (Replacement, Reduction and Refinement).

Mice used during this job have been obtained by crossing HSL-Lox/Lox mice

(Haemmerle, 2002) and Adiponectin-CreERT2 mice (Sassmann et al., 2010). Those with a

final Adiponectin-Cre-HSL lox/+ genotype where employed during the study.

Fifteen females compose this cohort. Eight of them (henceforth AdipoHSL+/- mice) were

injected intraperitoneally with 2mg of tamoxifen during five days. Control group

(henceforth AdipoHSL+/+ mice, n=7) followed the same protocol but injecting oil. (Figure

2.1).

A tamoxifen injection allowed the activation of the Cre-Recombinase enzyme and thus

the excision of a copy of the HSL gene in the CreLoxPAdipoHSL model.

Since week 10, mice were fed under a High fat diet (HFD) 45% fat.

Figure 2.1.- Mice genotype obtaining



5

Timeline of in vivo experiments can be consulted in Figure 2.2.

The mice were fasted between one and two hours before euthanize, to conduct gene

and protein expression tests. The death was carried out by decapitation, collecting the

blood in tubes coated with EDTA anticoagulant. Different organs were extracted and

frozen in liquid nitrogen: perigonadal and subcutaneous WAT (gWAT and iWAT) tissue,

brown fat (BAT), liver and soleus skeletal muscle. Then, tissue are conserved at -80ºC.

The blood was centrifuged 15 minutes at 4 ° C at 5000g to extract the plasma

(supernatant), which was frozen at -20ºC.

2.2 Echo Magnetic Resonance Imaging (EchoMRI)

EchoMRI is used to analyze mice’s body composition based on magnetic resonance

imaging technology. Each mouse is inserted into a clear plastic tube and placed in the

EchoMRI 3-in-1 System (Echo MedicalSystems, Houston, TX). Percentage of fat mass and

lean mass is quantified for each mouse at different weeks.

2.3 Insulin (ITT) and Glucose (GTT) Tolerance Tests

To evaluate the glycaemia regulation in vivo glucose and insulin tolerance tests are

performed. Mice are in a 6 hours fast state before test, in order to measure basal

tolerances. In GTT all mice are injected with 3 g of glucose per kg of body weight, 0.75 U

/ kg of insulin for the ITT. Using an Accu-check glucometer, the blood glucose is

Figure 2.2.- Experiments timeline. 2mg of tamoxifen (AdipoHSL+/-, n=8) or oil (AdipoHSL+/+, n=7) was injected during 5 days at the age of 14 weeks. Mice were fed under a HFD in week 10 post tamoxifen injection. They were euthanized in week 18. GTT= Glucose tolerance test. ITT= Insulin tolerance test.



6

measured by taking a drop of blood from the caudal vein 15 minutes before injection

and at 0, 15, 30, 60, 90 and 120 minutes after injection. In addition to GTT, insulin

concentration has been determined following 80-INSMS-E01, E10 "Mouse insulin ELISA"

protocol (ALPCO, 2015). Caudal blood was taken at time 0 and 15 during GTT for this

test.

2.4 Evaluation of gene expression

2.4.1 RNA extraction

The extraction of RNA was carried out according to the protocol provided by the Kit

RNeasyQiagen, based on a Phenol (Quiazol)-chloroform extraction, 700μL and 210μL

respectively for 50-100 mg of tissue in Precellys tubes with microspheres of ceramics.

Subsequently, filtration in RNAeasy columns with RPE 700μL and RW1 500μL buffers and

30-45μL of RNAse free water for the final elution. Total extracted RNA concentration

and purity evaluation is done by spectrophotometry in NanoDrop at 260/280 and 260 /

230nm. Samples are stored at -80ºC.

2.4.2 Retrotranscription - qPCR

To eliminate all possible DNA from the eppendorf, samples are subjected to a DNAse

(1.5μL) process. Afterwards, it is performed a retro-transcription in an inhibitory

environment of RNAsas (RNaseInhibitor 1μL). Mix contains 5 μg of RNA samples, 2μL of

specific primers (HSL gene and the housekeeping HPRT gene), 1μLMultiscribe Reverse

Transcriptase and 0.8μL of DNTPs. Final cDNA concentration is diluted to 5ng/μL and

frozen at -20 ° C.

From diluted cDNA, take 5μL per sample and add 7μL of the PCR mix. The mix is

comprised of FastSybr® Green Master Mix, primers interest genes (Table 1) and H2O

RNAse free. The analysis is carried out by StepOne Software 2.3



7

Gene Primer forward Primer reverse

HPRT TGGCCATCTGCCTAGTAAAGC GGACGCAGCAACTGACATTTC

Lipe (HSL) ACTCAACAGCCTGGCAAAAT AGGTCACAGTGCTTGACAGC

2.5 Protein quantification

2.5.1 Protein Extraction

For each sample, 500μL of RIPA buffer (Sigma R0278) enriched in antiproteases and

antiphosphatases (Sigma P5726, P0044, P8340) in a 1/1000th ratio. Between 50 and 100

mg of the WAT samples collected during euthanize are added to Precellys tubes with

ceramic microspheres with the buffer. Then it is crushed two times in Precellys at

5000rpm during 30 seconds and centrifuged at 12700 rpm for 20-40 minutes in 4ºC.

Supernatant is frozen at -20 ° C.

2.5.2 Protein quantification and Western-Blot

They are then diluted in denaturing buffer (SB4X) and heat up to 95ºC, allowing us to

perform Western Blot (BioRad) from 40 μg of protein extracts. After migration and

transfer to the membrane, labelling is performed by using mouse primary anti-HSL and

anti-GAPDH antibodies at 1/ 1000th, and secondary anti-mouse rabbit at 1 /10,000th

coupled to the HRP peroxidase (Cell Signaling Technology). Adding the HRP substrate

and then measuring the bioluminescence (Chemidoc - BioRad) allowed us protein

quantification.

2.6 Statistics

Statistics test were performed with GraphPadPrism program. T-tests or Mann-Whitney

are used for the comparison of two groups according to the normality of the distribution

of values, and ANOVA to compare more than two groups or kinetics by comparing two

or more groups. Significance has been studied by the p-value given by the program. P-

values below 0.001 are considered very significant and p-values below 0.05 significant.

Table 1. Primers used while PCR



8

CHAPTER 3. RESULTS

3.1 Model validation: the induction of the HSL deletion is different among the fat

depots, but protein expression has not a direct correlation with gene expression

levels.

Tamoxifen-induced HSL deletion in adipose tissue was verified in two different fat pads.

It shows a significant 40% mRNA decrease in AdipoHSL+/- subcutaneous tissue relative

to the control group (Figure 3.1a).

However, in perigonadal tissue there is no significant difference compared with the

control group. (Figure 3.1b).

Surprisingly, we found that HSL protein levels in the WAT do not vary between control

and induced groups (Figure 3.2) even though mRNA levels present in WAT were

significantly different.

Figure 3.1.- Quantification of HSL gene expression in AdipoHSL+/- mice induced with tamoxifen (black, n = 8) or oil (white, n = 7) in a) iWAt or b)pgWAT. Shown as a percentage of HSL expression versus the control *** p< 0.0001



9

3.2 HSL partial deletion induced during adulthood does not have an effect on

hypercaloric diet-induced weight gain.

Both groups of mice have the same weight gain (Figure 3.3a) and fat mass (Figure 3.3b)

gain before and after being fed in high fat diet.

3.3 In chow diet-fed mice, partial deletion of HSL in adulthood entails differences in

tolerance to glucose 6 weeks after induction.

Six weeks post-induction, a glucose tolerance test (GTT) performed on chow diet-fed

mice indicates that AdipoHSL+/- mice are more tolerant to glucose than the control

Figure 3.2.- Quantification of iWAT HSL protein expression in mice AdipoHSL+/- with tamoxifen (black, n = 8) versus control (white, n = 7), normalized according to GAPDH

Figure 3.3.- Measure of a) weight gain and b) % of fat mass gain, expressed as a variation relative to the weight at time 0 (pre-induction).



10

group.

-30 -15 0 15 30 45 60 75 90

100

200

300

AdipoHSL +/+

AdipoHSL +/-

**

% g

lycem

ia (

mg

/dl)

Time (min)

3.4 In vivo tests from weeks 15 and 16 show no significant difference when

comparing HSL partial deletion in adulthood and control groups.

However, the GTT performed fifteen weeks post-induction on mice under a HFD does

not show any differences between the two genotypes.

Insulin secretion was measured from blood samples extracted during this experiment at

the time of glucose injection and 15 minutes post-injection. No significant variation in

insulin concentration was found between the two groups. 16 weeks post-induction, an

ITT was conducted that also showed no difference.

CHAPTER 4. DISCUSSION

The aim of this work was to initiate the characterization of a new model of adipose tissue

specific heterozygosity for the HSL, which could facilitate this enzyme’s study and its role

in metabolism.

Figure 3.4.- Results of the GTT performed at the sixth week. Time 0 = glucose injection. AdipoHSL mice with tamoxifen (black, n = 8) versus control (white, n = 7). ** p < 0.001



11

-30 -15 0 15 30 45 60 75 90

100

200

300

400

AdipoHSL +/+

AdipoHSL +/-

gly

cem

ia (

mg

/dl)

Time (min)

0 15

0

1

2

3

4AdipoHSL +/-

AdipoHSL +/+

***

Time (min)

Insu

lin

e (

ng

/mL

)

0 50 100 1500

50

100

150

AdipoHSL +/+

AdipoHSL +/-

Time (min)

gly

cem

ia (

mg

/dl)

Figure 3.5.- a) Results of the GTT performed at the 15th week. b) Insulin-ELISA on blood from the 15th week. c) Results of the ITT performed during the 16th week. AdipoHSL mice with tamoxifen (black, n = 8) versus control (white, n = 7). *** p< 0.0001.



12

4.1 Model validation – genotype

qPCR in Tissues post sacrifice indicates the effectiveness of the induction. Comparing

the mRNA of the control group (AdipoHSL+/+) with the mRNA from the mice treated

with tamoxifen (AdipoHSL+/-) we found that in that

there are almost 50% less of AdipoHSL-mRNA in iWAT, which validates what was

expected

there is no decrease in pgWAT amount.

The result in pgWAT may be explained by two different hypotheses.

First one is based on the work of Kim et al (2014) which indicates that pgWAT has a

higher rate of turnover, increased by a HFD (Sakaguchi et al. 2017)(Kim et al. 2014). This

may cause that at the time of sacrifice no tamoxifen-induced adipocytes are left,

therefore an AdipoHSL+/+ genotype is shown by both groups. Another hypothesis is that

pgWAT cells do not respond properly to induction. Data obtained in the laboratory for

AdipoHSL-/- cells seem to support this idea, since neither show a full answer to

induction. However, the lack of prior literature or specific experiments does not give any

conclusive answer.

Regarding the data displayed in this work, it would be good to sacrifice the mice earlier.

This is to verify that there are less HSL transcription, solving the problem of renewal. The

results of Sakaguchi et al., 2017 support this idea. Also it would have to perform more

tests during a nearest stage, before renewal of tissue substitute induced cells.

4.2 Weigth gain

Previous studies about the HSL were based on the general depletion of HSL. They had

reported a HFD-induced obesity resistance in HSL -/- (Harada et al. 2003) whereas HSL

+/- mice did not show any variation in fat mass or body weight even if they showed an

amelioration in glucose and insulin tolerance (Girousse et al. 2013). Our experiment was

run to confirm if the result was linked to adipocyte-HSL or the general depletion.



13

As expected, inducible model do not show variation in fat mass or body weight, since a

partial reduction in the HSL gene expression does not affect the adipogenesis. This

correlates with HSL mice +/- (Girousse A, 2013). However, to corroborate Girousse et al

(2013) hypothesis, we should have executed experiments to control leptin levels or

energy expenditure.

4.3 Tolerance to glucose

Glucose tolerance tests were performed at the 6th week in a chow diet context and at

the 14th week, in a HFD context.

As it is showed in Figure 3.4, AdipoHSL+/- mice answer faster to glucose injection than

the AdipoHSL+/+ mice in week 6th GTT. It was already proved in humans that there is an

inverse correlation between lypolitic rate and glucose tolerance (Girousse A, 2013).

Therefore, if we extrapolate, it is normal that lower HSL expression carries to improved

glucose tolerance.

Nevertheless, Girousse et al test was ran out during a HFD context, thus our results of

6th week GTT should not be treated in the same way.

We should focus on the 2nd GTT, ran out the 15th week, and therefore when the

obesogenic context is achieved. At this time, any difference between groups is obtained.

This is explained if we refer to the amount of HSL protein present in the WAT removed

post-mortem. Since the lack of HSL is the responsible of differences in glucose and insulin

tolerances, an equal expression of protein between groups explains having the same

result in tolerance tests.

However the reason behind the different amounts in proteins is unknown, despite

presenting half of the gene expression.

Previous literature showed that obesity in humans lead to a decrease of HSL protein

expression (Langin et al. 2005). We may hypothesize that the forced decrease of HSL

due to the lack of gene, avoid the down regulation because of the obesity. Hence both



14

genotypes may be equilibrated in protein expression. To prove or refuse this hypothesis,

we could have as part of the cohort, some mice nourish in chow diet.

Another hypothesis could point to the effect of tamoxifen on mice. Tamoxifen binds to

estrogen receptor, and may generate physiological changes in the animal as lipoatrophy,

browning, decrease in appetite or adipogenesis ((Hesselbarth et al. 2015);(Liu et al.

2015)). However, it is considered that normal values are reached from the fourth week

post injection of tamoxifen(Liu et al. 2015) . So, it does not seem to be the best approach.

To prevent possible doubts, next performed experiment should be ran in both female

and male, to compare results since female are more affected by tamoxifen.

The third hypothesis is linked to the possibly different genotype at different time. It is

so due to the renewal of the adipose tissue (Kim et al. 2014). According to this

hypothesis, AdipoHSL +/- mice would show this differential phenotype in the sixth week

due to their lower HSL production. On the other hand, in the 15th week, there would be

different response to glucose because perigonadal adipose tissue would have already

renewed more quantity of fat cells and thus the expression of HSL would be

increasing. However, these results cannot be taken accurately, since during a GTT we

measure total body glucose tolerance, so we cannot exactly know each tissue

contribution (differences between pgWAT and iWAT, and especially muscle) to the test.

To clarify this question, a radioactive glucose-fluxes study could be carry out. By injecting

radioactive glucose in fast-mice and sacrificing them, it is possible to see the destiny.



15

CHAPTER 5. FUTURE PERSPECTIVES

To clarify further questions, we have propose to carry out the next experiments:

To circumvent the problem of adipocyte renewal we could either apply a second

injection of tamoxifen, or shorter the experiment timing.

Also we may suggest if HSL lipolytic activity and protein level are decreased, so we

should study fatty acids and glycerol plasma levels. We did not perform the consequent

experiment since mice were sacrificed in a relative fed state, meaning in a lipolysis basal

state, which was shown to not be decreased in vivo in HSL +/- (Girousse et al. 2013).

Measurement of glycerol and NEFAs have to be done after a fasting or subsequent to an

adrenergic agonist injection. As well, we should quantify HSL level at fat depots by

western blot and ectopic fat depots by lipidomics.

To study more about tolerance to insulin, we have to study insulin signalling and

evaluate the metabolic pathways known to be beneficial for insulin sensitivity. Insulin

signalling is evaluated by western blot. The inflammation pathway and the de novo

lipogenesis pathway are both analyse by gene expression, measuring ChREBP, FAS, ATGL

or F4/80)

When we perform GTTs, we are studying the general glucose uptake, which is not just

done by the adipose tissue but also by the muscle and the liver. To further

comprehension about the specific adipose HSL effect, we should study the glucose

uptake measurement after a radiolabelled GTT.

To sum up. We have obtained a correct new mouse model without half of HSL adipose

specific expression. It presents same weight gain and greater glucose uptake in chow

diet compared to control group. Henceforth it does not show no differences under a

HFD context in insulin and glucose tolerance as was expected. This may be linked to a

HFD compensatory effect in lipolysis, tamoxifen influence or cell renewal that reverses

the AdipoHSL removal. It will be necessary to run out more experiments to delve into

the knowledge of the pathways affected by HSL and its effect in a obesogenic context.



16

REFERENCES

Aranceta-Bartrina, Javier. 2016. “Prevalencia de Obesidad General y Obesidad Abdominal En La

Población Adulta Española (25–64 Años) 2014–2015: Estudio ENPE.” Revista Española de

Cardiología 69(6): 579–87.

https://linkinghub.elsevier.com/retrieve/pii/S0300893216001068 (February 18, 2019).

Boden, Guenther. 2011. “Obesity, Insulin Resistance and Free Fatty Acids.” Current Opinion in

Endocrinology, Diabetes and Obesity 18(2): 139–43.

http://content.wkhealth.com/linkback/openurl?sid=WKPTLP:landingpage&an=01266029-

201104000-00008.

Calle, Jose Ramón. 2011. “Situación Actual de La Diabetes En España. Estudio [email protected].”

https://www.fundaciondiabetes.org/general/articulo/58/situacion-actual-de-la-diabetes-

en-espana-estudio-dibetes (June 22, 2018).

Castro, Ana Valeria B, Cathryn M Kolka, Stella P Kim, and Richard N Bergman. 2014. “Obesity,

Insulin Resistance and Comorbidities? Mechanisms of Association.” Arquivos brasileiros

de endocrinologia e metabologia 58(6): 600–609.

https://www.ncbi.nlm.nih.gov/pubmed/25211442.

Fundación para la diabetes. “Riesgo de Diabetes Tipo 2.”

http://www.fundaciondiabetes.org/prevencion/310/riesgo-de-diabetes-tipo-2.

Girousse, Amandine et al. 2013. “Partial Inhibition of Adipose Tissue Lipolysis Improves

Glucose Metabolism and Insulin Sensitivity without Alteration of Fat Mass.” PLoS biology

11(2): e1001485–e1001485. https://www.ncbi.nlm.nih.gov/pubmed/23431266.

Harada, Kenji et al. 2003. “Resistance to High-Fat Diet-Induced Obesity and Altered Expression

of Adipose-Specific Genes in HSL-Deficient Mice.” American journal of physiology.

Endocrinology and metabolism 285(6): E1182-95.

Hesselbarth, Nico et al. 2015. “Tamoxifen Affects Glucose and Lipid Metabolism Parameters,

Causes Browning of Subcutaneous Adipose Tissue and Transient Body Composition

Changes in C57BL/6NTac Mice.” Biochemical and Biophysical Research Communications

464(3): 724–29. http://www.sciencedirect.com/science/article/pii/S0006291X15302461.

Kim, Soo M et al. 2014. “Loss of White Adipose Hyperplastic Potential Is Associated with



17

Enhanced Susceptibility to Insulin Resistance.” Cell metabolism 20(6): 1049–58.

https://www.ncbi.nlm.nih.gov/pubmed/25456741.

Lafontan, Max, and Dominique Langin. 2009. “Lipolysis and Lipid Mobilization in Human

Adipose Tissue.” Progress in Lipid Research 48(5): 275–97.

https://linkinghub.elsevier.com/retrieve/pii/S0163782709000204.

Langin, Dominique et al. 2005. “Adipocyte Lipases and Defect of Lipolysis in Human Obesity.”

Diabetes 54(11): 3190 LP-3197.

http://diabetes.diabetesjournals.org/content/54/11/3190.abstract.

Large, V et al. 1998. “Hormone-Sensitive Lipase Expression and Activity in Relation to Lipolysis

in Human Fat Cells.” Journal of lipid research 39(8): 1688–95.

Liu, L et al. 2015. “Tamoxifen Reduces Fat Mass by Boosting Reactive Oxygen Species.” Cell

Death &Amp; Disease 6: e1586. https://doi.org/10.1038/cddis.2014.553.

Morigny, Pauline, Marianne Houssier, Etienne Mouisel, and Dominique Langin. 2016.

“Adipocyte Lipolysis and Insulin Resistance.” Biochimie 125: 259–66.

https://linkinghub.elsevier.com/retrieve/pii/S0300908415003442.

Mouri, MIchelle, and Madhu Badireddy. 2019. “Hyperglycemia.” In Treasure Island (FL).

Sakaguchi, Masaji et al. 2017. “Adipocyte Dynamics and Reversible Metabolic Syndrome in

Mice with an Inducible Adipocyte-Specific Deletion of the Insulin Receptor.” Cell

Metabolism 25(2): 448–62.

http://www.sciencedirect.com/science/article/pii/S1550413116306416.

World Health Organization. 2018a. “Diabetes.” https://www.who.int/news-room/fact-

sheets/detail/diabetes.

World Health Organization. 2018b. “Obesity and Overweight.” https://www.who.int/news-

room/fact-sheets/detail/obesity-and-overweight.

grado en biotecnologÍa departamento de producciÓn...

Documents