epidemiología del botulismo aviar en el...

Epidemiología del botulismo aviar en el Parque

Nacional de Las Tablas de Daimiel y otros humedales

de Castilla-La Mancha

Memoria presentada por

Ibone Anza Gómez

para optar al grado de doctor

por la Universidad de Castilla-La Mancha

VºBº de los Directores

Dr. Rafael Mateo Soria

Instituto de Investigación en Recursos

Cinegéticos IREC (CSIC-UCLM-JCCM)

Dra. Mª Dolors Vidal Roig

Facultad de Medicina de Ciudad Real

(UCLM)

UNIVERSIDAD DE CASTILLA-LA MANCHA.

DEPARTAMENTO DE CIENCIA Y TECNOLOGÍA AGROFORESTAL Y GENÉTICA

Epidemiology of avian botulism in the Tablas de

Daimiel National Park and other wetlands of Castilla-

La Mancha

Ibone Anza Gómez

PhD Thesis

Ciudad Real, 2014

Instituto de Investigación en Recursos Cinegéticos IREC (CSIC-UCLM-JCCM)

A mi familia y amigos

A todos los que luchan

por la conservación

AGRADECIMIENTOS

El mayor agradecimiento de esta tesis es para mis directores Rafa y Dolo por su

perseverancia, ganas de trabajar y convicción sin las cuales no se si hubiese sido posible

este trabajo y menos en cuatro años. Gracias a los dos porque me habeis facilitado

mucho el camino.

Por supuesto agradecer a mis padres “Aita” y “Ama” su apoyo incondicional en todo

momento, lo cual hace que estos tiempos que corren sean más llevaderos y me ha

permitido disfrutar del proceso de escribir esta tesis. Y al resto de mi familia, Lucia por

ser una hermana muy parecida a mi con la que me rio mucho, a mis abuelos porque sé

que les ilusiona esta tesis y a mis tios y primos, porque aunque no nos vemos mucho los

siento cercanos.

Ahora nombro sin orden de importancia según se me va ocurriendo…

Otro elemento muy importante en estos años ha sido “El Chaparrillo”, sus habitantes y

su veterinaria Elena que, además de ayudarme en muchos experimentos, me ha

enseñado muchas cosas de fauna, me ha dado la oportunidad de acercarme a las

“alimañas” que tanto me gustan y sobre todo ha hecho de Ciudad Real un lugar muy

interesante y divertido para mi…. en realidad fue el motivo principal por el que vine

aqui, porque siempre había querido estar en un Centro de Recuperación asi. También

tengo que agradecerle esos increíbles trekkings que hemos hecho y haremos.

A toda la gente del IREC por ser tan diversos y tener muchas ganas de aprender y

enseñar creando un ambiente “bichero” muy motivante. De la gente del IREC les

agradezco estos últimos meses y les doy animos para acabar conmigo a Ana y a Paco

que ya casi tienen la tesis también. Muchisimas gracias a todos los doctorandos de Rafa

que nos entendemos tan bién y nos damos ánimos mutuamente: Ana, Jaime, Nuria,

Jhon, Pilar, Mónica, Esther. También a los doctores y a los técnicos Manu, Pablo, Inés,

Sergio por sus buenos consejos. Importante agradecerle a Xurxo “el gallego” haberme

enseñado a diferenciar las aves acuáticas, algo que ha sido básico para realizar esta tesis.

Otro especial agradecimiento a Celia, Sandra y Jordi por su gran trabajo y ayuda en los

muestreos por Las Tablas y en nuestra querida Navaseca. Y a David Sánchez le

agradezco pasarme información sobre las depuradoras y sus opiniones sobre mis

resultados, siempre dispuesto a ayudar.

A la gente que me acogió durante mis dos estancias en París y Suecia, los técnicos y

predoctorales del departamento de anaerobios del Instituto Pasteur y en especial a

Hanna Skarin del SVA, Uppsala, que me enseño nuevas técnicas y se preocupó

muchísimo por mi durante mi estancia con ella a pesar de la gran cantidad de trabajo

que tenía.

A Chai tengo muchisimo que agradecerle, él ya lo sabe…suerte que lo encontré! por ser

el mejor compañero de aventuras, muy planeador y de gran confianza. Juntos hemos

aprendido muchas cosas de escalada, montaña y de la vida y las que

quedan……Rabadá….!!!!!! Y por suspuesto te agradezco los modelos de R.

Al Plafón por ser el centro de reunión para mis escaladas y aventuras por el monte, a su

gente tan autentica que me ofreció ese vínculo local que ahora tanto me une a esta tierra

llana. Sin estas aventuras, estos años de tesis no se como hubiesen sido… hubiese

publicado más?? Pues seguro que sí! Especial agadecimiento a los super Migueles por

haberme hecho una montañera fuerte casi como ellos y porque sin paciencia me han

hecho subir a casi todas las cumbres emblemáticas de España y ya casi he escalado 50

clásicas ibéricas…..y de los Migueles a Sevi también le agradezco sus razonamientos y

sus conocimientos informaticos que tantas veces me han salvado y puede que aun

tengan que salvar esta tesis. Aunque no sea del plafon a Manu el “artificiero” le

agradezco haberme enseñado esa ancestral técnica de los estribos y haberse embarcado

conmigo en la Oeste del Piku que tanto me obsesionó este verano y sin lo cual aun

estaría pensando en como subir a Picos de Europa y no hubiese terminado la tesis… Y a

Vari le agradezco haberme hecho romper la barrera del sexto grado en aquel viaje a

Chulilla.

A Marta del Circo Culipardo le agradezco muchísimo tener ese espacio reducido de

circo que ha mantenido mi poca flexibilidad y también le ha dado el punto bohemio que

le faltaba a Ciudad Real para ser casi perfecta…sigue dándonos clases de fuerza,

flexibilidad y aéreos porfavor!

Al grupo de los marcianitos Marchello, Tiri, Ana, Tula, Sergio, Rodri, Guili, Rafiki,

Angel y a la manada perdida Chipi y Ivan por su amistad andaluza-manchega, sus

diferentes puntos de vista y cada uno tiene lo suyo…

A mis amigas de toda la vida San, Ane, Ale, Amita, Nai porque me han animado

siempre y me dan ese bienstar de sentirte querido….y a todos los patxis de mi tierra de

la que tan orgullosa estoy. A Imanol mas que a los otros porque el también ayudó en

los muestreos de esta tesis. Y también a las que no lo han sido tan toda la vida pero si

muy amigas Itxaso, Sun y Lobna que me ayudaron a sacarme la carrera y el master.

A las chicas manchegas (y andaluzas) que me dan el toque femenino y yoguico, Covi,

Maria, Alba, Marisa y Raspa…y a Raspa le agradezco hasta el infinito haberme

mejorado la calidad de los gráficos en uno de los artículos.

Bueno y como en todos los agradecimientos seguro que se me olvida muchísima gente

pero nombrarlos a todos es imposible y tantos buenos recuerdos y tantas buenas

personas me hacen llorar asi que los dejo asi…..me siento muy afortunada de haberme

encontrado con toda la gente con la que me he encontrado a lo largo de mi ya larga vida.

Por último, les agradezco esta tesis a las aves acuáticas que viven en los humedales y

tantos misterios esconden, agenas a todos nuestros trabajos y preocupaciones, ellas son

la inspiración.

INTRODUCCIÓN GENERAL ..................................................................................... 1

1. El botulismo .............................................................................................................. 1

2. Botulismo aviar ....................................................................................................... 11

3. Pérdida de humedales: el caso de la reserva de la Biosfera de la Mancha-Húmeda 23

Referencias ..................................................................................................................... 29

ORGANIZACIÓN DE LA TESIS Y OBJETIVOS .................................................. 42

CAPÍTULO 1. Cepas de Clostridium botulinum de la misma rama causan el botulismo

aviar en el Sur y en el Norte de Europa .......................................................................... 44

1. Introduction ............................................................................................................. 47

2. Material and methods .............................................................................................. 48

3. Results ..................................................................................................................... 52

4. Discussion ............................................................................................................... 53

5. Conclusions ............................................................................................................. 55

Acknowledgements ........................................................................................................ 55

References ...................................................................................................................... 56

CAPÍTULO 2. Factores ambientales que influyen en la prevalencia de Clostridium

botulinum tipo C/D en humedales mediterráneos no permanentes ................................ 59

1. Introduction ............................................................................................................. 62

2. Material and methods .............................................................................................. 64

3. Results ..................................................................................................................... 69

4. Discussion ............................................................................................................... 78

Acknowledgments .......................................................................................................... 85

References ...................................................................................................................... 86

Supplemental material .................................................................................................... 93

CAPÍTULO 3. Eutrofización y bacterias patógenas como factores de riesgo de

botulismo aviar en humedales que reciben efluentes de estaciones depuradoras de aguas

residuales ........................................................................................................................ 97

1. Introduction ........................................................................................................... 102

2. Material and methods ............................................................................................ 104

3. Results ................................................................................................................... 113

4. Discussion ............................................................................................................. 122

5. Conclusions ........................................................................................................... 126

Acknowledgments ........................................................................................................ 127

References .................................................................................................................... 127

CAPÍTULO 4. Nueva perspectiva en la epidemiología de los brotes de botulismo aviar:

las moscas necrófacas como vectores de C. botulinum tipo C/D ................................. 135

1. Introduction ........................................................................................................... 138


3. Results and discussion ........................................................................................... 144

4. Perspectives ........................................................................................................... 149


References .................................................................................................................... 151

CAPÍTULO 5. Diferencias en la susceptibilidad al botulismo y en la excreción de C.

botulinum tipo C/D entre especies de aves acuáticas ................................................... 156

1. Introduction ........................................................................................................... 160


3. Results ................................................................................................................... 168

4. Discussion ............................................................................................................. 175

5. Conclusions ........................................................................................................... 181


References .................................................................................................................... 182

Supplemental material .................................................................................................. 188

DISCUSIÓN GENERAL ........................................................................................... 190

1. El agente causante de los brotes ............................................................................ 191

2. Historial de brotes en La Mancha Húmeda (Ciudad Real y Cuenca) y las aves

afectadas ....................................................................................................................... 192

3. Factores ambientales relacionados con los brotes y el problema de las aguas

residuales ...................................................................................................................... 194

4. Las moscas como vectores de C. botulinum tipo C/D........................................... 197

5. Las aves acuáticas como portadoras de C. botulinum tipo C/D ............................ 199

6. Invertebrados acuáticos como fuente alternativa de intoxicación ......................... 201

7. Síntesis .................................................................................................................. 202

Referencias ................................................................................................................... 204

CONCLUSIONES ...................................................................................................... 209

Intriducción general

1

INTRODUCCIÓN GENERAL

1. El botulismo

El botulismo es una intoxicación causada por la acción de las neurotoxinas

botulínicas (BoNTs) y caracterizada por una parálisis flácida de los músculos. Esta

enfermedad afecta a hombres y a animales vertebrados salvajes y domésticos como

aves, caballos, vacas, roedores, zorros y hurones de peletería y peces (Lindström et al.,

2004; Collins y East, 1998; Defilippo et al., 2013). El nombre “botulismo” deriva de la

palabra latina “botulus” que significa salchicha y se comenzó a usar en Europa Central

en el siglo XVIII para describir una enfermedad que producía parálisis muscular,

dificultades respiratorias, y un alto índice de mortalidad frecuentemente asociado al

consumo de salchichas (Peck et al., 2011).

1.1 Las neurotoxinas botulínicas BoNTs

Las BoNTs son proteínas que en base a sus características serológicas se

clasifican en 7 tipos denominadas de la A a la G, aunque recientemente se ha

descubierto un nuevo tipo, el H, que está aún por confirmar. Estas toxinas son muy

diversas y existen más de 40 subtipos con diferentes secuencias de aminoácidos

(Rossetto et al., 2014). Las BoNTs se encuentran entre las toxinas más potentes

conocidas y el Centro de Control y Prevención de Enfermedades de los Estados Unidos

(CDC) las ha clasificado en la “categoría A” entre los agentes de mayor riesgo para

ataques bioterroristas debido a su letalidad, su fácil producción y la necesidad de largos

cuidados intensivos en el hospital para su tratamiento en humanos (Arnon et al., 2001).

También se han incluido en la lista australiana de agentes bioterroristas y la Unión

Tesis doctoral – Ibone Anza Gómez

2

Europea las considera posibles agentes de agroterrorismo debido a los serios problemas

y pérdidas que causa entre animales domésticos (Woudstra et al., 2013).

1.2 Modo de acción

Las toxinas botulínicas son proteínas de 150 kDa con actividad de zinc-

endopeptidasa. Las BoNTs se secretan como toxinas progenitoras formadas por una

neurotoxina y por varios componentes proteicos no-tóxicos que las protegen y

transportan por el torrente circulatorio desde el intestino hasta su lugar de acción en la

unión neuromuscular (Rossetto et al., 2014). La toxina madura está formada por dos

cadenas de aminoácidos unidas por un puente disulfuro: la cadena pesada (H) de 100

kDa y la cadena ligera (L) de 50 kDa. La cadena H se une a la membrana sináptica de la

motoneurona y transloca la cadena L por endocitosis al citosol neuronal. Una vez en el

citosol, la actividad catalítica de la cadena L actúa cortando las proteínas del grupo

SNARE (acrónimo del inglés “Soluble NSF Attachment Receptor”), encargadas de la

exocitosis y liberación de acetilcolina, bloqueando así el impulso nervioso y

produciendo una parálisis flácida de los músculos (Rossetto et al., 2014). Cada tipo de

BoNT corta las proteínas tipo SNARE por un lugar diferente y específico: los tipos A y

E cortan SNAP-25, los tipos B, D, F y G cortan la sinaptobrevina, y el tipo C corta la

sintaxina y SNAP-25 (Breidenbach y Brunger, 2005) (Fig. 1). Las BoNT son muy

específicas y solo se unen a lugares concretos de las terminales nerviosas periféricas de

vertebrados, lo que explica su eficacia y potencia. La acción de las BoNT es reversible

in vivo y los afectados, si sobreviven, se recuperan del todo (Rossetto et al., 2014).


3

SB

S-25

STX

Fig. 1. Mecanismo de acción de las BoNTS. (a) Modelo de intoxicación en 4 pasos (i) unión

específica de la cadena pesada (HC, negro) a receptores de la membrana neuronales de las

terminaciones nerviosas periféricas, (ii) endocitosis, (iii) translocación de la cadena ligera (LC,

círculo gris) al citosol neuronal mediada por la HC y (iv) LC cataliza la proteólisis en lugares

específicos de las proteínas SNARE encargadas de la liberación de acetilcolina al espacio

intersináptico. (b) Localizaciones de los lugares específicos de corte de las 7 BoNTs en las

proteínas SNARE: sinaptobrevina (SB), sintaxina (STX) y SNAP-25 (S-25). (Breidenbach y

Brunger, 2005).

1.3 El agente: Clostridium botulinum

Las BoNTs son sintetizadas por bacilos Gram-positivos, esporulados y

anaerobios estrictos del género Clostridium. Este género agrupa más de 150 especies

ampliamente distribuidas en el medio ambiente y en las regiones anaerobias del tracto

intestinal de vertebrados, donde se encuentran en forma de esporas de resistencia que

pueden perdurar durante mucho tiempo hasta que se dan las condiciones adecuadas para

su germinación (Rossetto et al., 2014). En concreto, las BoNT son producidas

principalmente por la especie Clostridium botulinum y secundariamente por Clostridium

baratii, Clostridium butyricum y Clostridium argentinense (Peck et al., 2011; Rossetto

et al., 2014).


4

C. botulinum se subdivide en 7 tipos según la BoNT que produce aunque,

atendiendo a sus características genéticas y fisiológicas, también puede dividirse en

cuatro grupos (I-IV) tan diferentes entre sí que podrían considerarse especies distintas.

Cada grupo puede producir varias toxinas y una misma toxina puede ser producida por

diferentes grupos (Hill et al., 2007). El grupo I produce las toxinas A, B y F, el grupo II

produce las toxinas B, E y F, el grupo III la C y la D y el grupo IV la G, E y la F. En la

Tabla 1 se presentan las características permanentes de los diferentes grupos.

Los grupos I y II están asociados con brotes de botulismo humano y animales

mientras que el III es casi exclusivo de animales (Lindström y Korkeala, 2006).

Además, existen cepas que producen más de una toxina, como los serotipos Ab, Ba, Af

y Bf, y cepas que producen toxinas mosaico con características intermedias entre dos

toxinas (Lindström y Korkeala, 2006; Hill et al, 2007) como el tipo C/D y D/C que

afectan a aves y vacuno respectivamente (Takeda et al., 2005; Woudstra et al., 2012).

Tabla 1. Características permanentes de los diferentes grupos metabólicos de Clostridium sp

productores de neurotoxina botulínica (Popoff, 1995; Collins y East, 1998)

Características

GRUPO

I II III

IV

C.

argentinense

C.

butyricum

C.

baratii

Tipo de toxina A,B,F B,E,F C,D G E F

Proteólisis + - - + - -

Lipasa + + + - - -

Gelatinasa + + + + - -

Fermentación de la

glucosa + + + - + +

Tª de crecimiento (ºC) 10-48 3,3-45 15-50 20-45 10-50 20-50

Tª óptima (ºC) 30-40 25-30 30-37 30-37 30-37 30-37

Termo resistencia de las

esporas (ºC)

104-121

D 6-0,2

77-82

D 4-0,3

104

D 0,02-0,9

82-120

D 5,9

D= tiempo en minutos necesario para inactivar el 90% de las esporas a una determinada temperatura.


5

Las BoNT están codificadas por el gen bot cuya localización en el genoma varía

con la cepa de C. botulinum. Así, las cepas de los serotipos A, B, E y F tienen el gen bot

insertado en el cromosoma bacteriano. Por su parte, las cepas de los serotipos C, D y sus

mosaicos tienen el gen bot incluido en un plásmido circular perteneciente a un profago

que presenta lisogenia inestable, es decir, el gen lo adquieren al infectarse con un virus

profago, lo pueden perder durante la multiplicación y volver a recuperarlo por

reinfección (Eklund y Poysky, 1974; Sakaguchi et al., 2005). Por último, las cepas del

serotipo G tienen el gen incluido en un plásmido (Hill et al., 2007).

1.4 Vías de intoxicación

Existen cuatro vías de intoxicación: la oral, la toxiinfección, la cutánea (a través

de heridas) y la iatrogénica (Rossetto et al., 2014).

La oral es la vía de intoxicación más común y se produce al ingerir la toxina

preformada en el exterior junto con el alimento. En humanos, está asociado a

conservas y carnes fermentadas en las que C. botulinum ha producido toxina

durante el proceso de anaerobiosis. Por su parte, en animales se asocia a la

ingestión de cadáveres o de los invertebrados que se desarrollan sobre ellos.

La toxiinfección se da principalmente en niños menores de un año dado que su

flora intestinal no está aún desarrollada y permite que C. botulinum colonice el

colon, donde produce toxina que pasa a la sangre (Midura et al., 1996). También

se puede dar en adultos con disfunciones intestinales o que han sido sometidos a

largos tratamientos con antibióticos (Rossetto et al., 2014). En animales, este

tipo de botulismo se ha descrito en potros (Swerczek et al., 1980) y se ha

sugerido que puede darse en pollos de engorde (Miyazaki y Sakaguchi, 1978).


6

La vía cutánea es menos frecuente que las anteriores. En este caso, C. botulinum

se multiplica y produce toxina en el ambiente anaeróbico dentro de las heridas.

Se da sobretodo en personas drogodependientes por venopunción. También se

ha descrito en caballos, asociado a úlceras o castración (Bernard et al., 1987;

Liguori et al., 2008) y en pollos de engorde tras ser castrados (Trampel et al.,

2005).

El botulismo iatrogénico se asocia al abuso de Botox (marca comercial más

conocida de la forma de toxina botulinica cosmética; Rossetto et al., 2014).

1.5 Diagnóstico y métodos de detección

El diagnóstico del botulismo se basa en la sintomatología clínica (síntomas de

parálisis flácida) y en la ausencia de lesiones en la necropsia (si hay muertos) apoyado

en la confirmación laboratorial de la presencia de la toxina activa en sangre o en heces

de los pacientes o animales afectados (Rocke y Friend, 1999; Lindström y Korkeala,

2006). La detección del microorganismo, C. botulinum, en heces, contenido gástrico o

heridas ayuda a confirmar el diagnóstico (Lindström y Korkeala, 2006).

1.5.1 Cultivos y aislamiento del microorganismo

C. botulinum necesita un ambiente anaerobio para crecer lo que dificulta su

aislamiento; es necesario usar jarras anaerobias o cámaras de anaerobiosis, desoxigenar

todos los medios “previo uso” y usar indicadores de anaerobiosis. Para detectar y aislar

C. botulinum, primero se cultivan las muestras en medio líquido en el que se confirma la

presencia de la bacteria por bioensayo o por PCR, a continuación las muestras positivas

se cultivan en medio sólido y por último las colonias positivas se vuelven a confirmar


7

(Lindström y Korkeala, 2006). Los medios líquidos más empleados son el “chopped-

meat-glucose-starch”; “cooked-meat medium”; “reinforced clostridial”; “fastidious

anaerobe” o medios que contengan combinaciones de triptona, peptona, glucosa,

levadura, y tripsina. Ninguno de estos medios es selectivo, por lo que permiten crecer

un gran número de microorganismos y dificulta el aislamiento. Para medios sólidos se

utiliza agar sangre o McClung Toabe Agar con yema de huevo, este último permite ver

la reacción lipasa y lecitinasa positivas que produce C. botulinum (Fig. 2), tampoco

existen medios sólidos selectivos (Lindstrom y Korkeala, 2006; Skarin et al., 2010). En

el caso de C. botulinum del grupo III tiene el problema añadido de que durante los

cultivos puede perder el fago que contiene el gen bot que codifica la neurotoxina

(Eklund et al., 1974), lo que hace imposible caracterizar las cepas aisladas por

bioensayo, ya que las colonias no producen toxina, o por PCR.

Fig. 2. Clostridium botulinum tipo C, cepa 07-BKT028387, en cultivo puro de McClung Toabe

agar. Halo opaco rodeando las colonias (lecitinasa +) y brillo iridiscente en la superficie de

desarrollo (lipasa +). (Imagen tomada del material suplementario de Skarin et al., 2010).


8

1.5.2 Detección de neurotoxina

1.5.2.1 Bioensayo en ratón

El bioensayo en ratón es el método de referencia para la detección de la toxina

botulínica. Este test se basa en inyectar la muestra problema (suero u otra muestra

diluida en un tampón) intraperitonealmente a dos grupos de ratones de laboratorio: un

grupo con la muestra sospechosa y otro con la misma muestra neutralizada con

antitoxina polivalente o hervida (la toxina es termolábil). Si la muestra contiene la

toxina, los ratones que han recibido la muestra sin tratar desarrollan síntomas de

botulismo (pelo erizado, parálisis del tercio posterior, dificultad respiratoria que provoca

cintura de avispa y muerte), mientras que los ratones que han recibido la muestra tratada

sobreviven. Estos síntomas normalmente se desarrollan durante las primeras 24 horas,

pero pueden tardar varios días en aparecer. Posteriormente el tipo de toxina causante del

brote se determina mediante un test de neutralización con antitoxina específica (CDC,

1998). Varios ratones se inyectan con la muestra positiva neutralizada con una de las

antitoxinas de las que se sospecha; el ratón que sobrevive es el que había recibido la

antitoxina adecuada. Este método se puede usar para detectar toxina en suero, así como

en muestras biológicas (heces, alimentos, contenido gástrico…), ambientales

(sedimentos) y cultivos. La técnica es específica y sensible pero requiere mucho tiempo,

instalaciones para ratones y conlleva problemas éticos. Además, los resultados no son

siempre fáciles de interpretar ya que el ratón puede mostrar síntomas inespecíficos o

morir antes de darlos (CDC, 1998; Lindström y Korkeala, 2006), por eso se están

buscando técnicas de referencia alternativas.


9

1.5.2.2 Métodos inmunológicos

Existen varios métodos inmunológicos para la detección de los diferentes tipos

de BoNT: radioinmunoensayo, difusión en gel, hemoaglutinación pasiva y ELISAs,

siendo este último el más utilizado (Lindström y Korkeala, 2006). Técnicamente, los

inmunoensayos son más sencillos, rápidos y permiten analizar un mayor número de

muestras que el bioensayo, pero la mayoría han resultado ser menos sensibles y

específicos. Los principales problemas de estas técnicas son que detectan toxina

biológicamente inactiva y que se pueden producir reacciones cruzadas entre toxinas

dando falsos positivos. Además, variaciones genéticas entre las diferentes toxinas

pueden repercutir en la afinidad de los anticuerpos, dando también falsos negativos

(Ekong, 2000; Lindström y Korkeala, 2006). A pesar de ello, estas técnicas se han

refinado y la sensibilidad y especificidad están alcanzando las del bioensayo (Ekong,

2000).

1.5.2.3 Espectrometría de masas (Endopep-MS)

La espectrometría de masas es el método desarrollado más recientemente. Se

basa en la detección in vitro de los péptidos que forman las toxinas botulínicas tras

cortar las proteínas SNARE por puntos específicos. Se han desarrollado ensayos para

las diferentes toxinas pero sólo se comercializan para el tipo A. Potencialmente esta

técnica podría reemplazar al bioensayo porque detecta toxina biológicamente activa y

porque está resultando ser muy sensible y específica. La gran desventaja es que necesita

equipos muy caros y personal especializado, por lo que no se puede instalar en todos los

laboratorios. Por otra parte, al ser un método novedoso aun no se ha validado con

muestras complejas como alimentos o heces (Lindström y Korkeala, 2006). El método


10

en principio se desarrolló para las toxinas A, B, E y F que afectan a humanos (Kalb et

al., 2006) y posteriormente para las toxinas C y D que afectan a animales (Hedeland et

al., 2011).

1.5.3 Detección molecular del gen que codifica BoNT con la técnica PCR

Este método se basa en hacer millones de copias de partes específicas de genes

diana de un organismo para facilitar su detección en una muestra. En los últimos años,

se han desarrollado muchos protocolos de PCR para la detección de C. botulinum. Esta

técnica es sensible y específica, además es más rápida que el cultivo y el bioensayo, y

permite el análisis de un gran número de muestras, lo que es importante en estudios

epidemiológicos. Otra ventaja es que muchos laboratorios tienen los equipos necesarios

y personal cualificado para su uso (Lindström y Korkeala, 2006). La desventaja es que

la mayoría de los protocolos para C. botulinum (exceptuando alguno de PCR de

retrotranscriptasa inversa) solamente detectan el gen de la neurotoxina bot y no detectan

la actividad del gen ni la toxina. A esto se añade que, al detectar también células

muertas, puede dar falsos positivos (Wolffs, 2005; Lindström y Korkeala, 2006).

Además, en el caso de C. botulinum tipo III que puede perder el gen bot durante el

cultivo (Eklund et al., 1974), el número de falsos negativos aumenta. Otro problema es

que normalmente el número de células de C. botulinum presentes en las muestras es

muy bajo y aparecen en forma de esporas de resistencia, por lo que la detección directa

del microorganismo suele fallar. Además, muestras complejas como sedimentos y heces

suelen portar inhibidores de la PCR (Tebbe y Vahjen, 1993). Esta falta de sensibilidad

se puede solucionar mediante un paso previo de enriquecimiento de la muestra en caldo

de cultivo para germinar las esporas, aumentar el número de microorganismos y diluir


11

los inhibidores (Franciosa et al., 1996; Lindström y Korkeala, 2006; Prèvot et al., 2007;

Vidal et al., 2011). La PCR no es adecuada por si sola para el diagnóstico de botulismo,

pero ayuda al aislamiento y caracterización de cepas de C. botulinum y permite estudios

ecológicos y epidemiológicos en los que se requiere analizar un gran número de

muestras en poco tiempo para detectar la presencia de la bacteria (Franciosa et al.,

1996).

2. El botulismo aviar

2.1 Historia

Los primeros brotes de botulismo aviar se identificaron alrededor de 1910 en el

oeste de América del Norte y en Canadá, donde regularmente se daban brotes de

mortalidad de millones de aves. A esta enfermedad se le llamaba “western duck

sickness” (fiebre occidental de los patos) o “limberneck” (cuello flexible, debido a la

característica caída del cuello que produce esta intoxicación en patos). Posteriormente,

en los años 30, estas mortalidades se asociaron con botulismo tipo C. Después se han

documentado brotes de botulismo aviar en Australia (1934), Rusia (1957), Suecia y

Dinamarca (1965), Inglaterra (1969), Holanda (1970), Sudáfrica (1965), Nueva Zelanda

(1971), Japón (1973), Argentina (1979) y Brasil (1981). El botulismo aviar ha sido

confirmado en al menos 28 países en todos los continentes menos en la Antártida

(Rocke, 2006).


12

2.2 Tipos de C. botulinum causantes de botulismo aviar.

Anteriormente, los brotes de botulismo aviar se asociaban con C. botulinum tipo

C, pero en los últimos años se ha descubierto que, al menos en Europa y probablemente

en otras zonas del mundo, el mosaico tipo C/D es predominante y causa brotes tanto en

aves silvestres como domésticas (Skarin et al., 2010; Woudstra et al., 2012). El gen bot

del mosaico C/D comprende 2/3 de la parte amino terminal del gen bot tipo C y 1/3 de

la parte carboxil terminal del gen bot tipo D (Moriishi et al., 1996), por lo que la toxina

mosaico resultante se puede neutralizar tanto con antitoxina C como con la D. Además,

se ha demostrado que BoNT C/D es más letal para las aves que los tipo C o D (Takeda

et al., 2005). Por otra parte, en los Grandes Lagos de los Estado Unidos los brotes se

asocian con botulismo tipo E y afectan a aves piscívoras (Yule et al., 2006).

2.3 Importancia de la enfermedad

El botulismo aviar es una de las enfermedades de aves acuáticas más

importantes a nivel global porque anualmente mata a miles o incluso millones de

individuos de muchas especies diferentes (solo los buitres parecen ser resistentes),

incluyendo algunas en peligro y, además, parece que está extendiendo su rango

geográfico (Friend et al., 2001). En un solo brote pueden morir de cientos a millones de

aves, algunos ejemplos de mortalidades de aves acuáticas durante brotes de botulismo

en diferentes lugares del mundo se dan en la Tabla 2.

La propagación de esta intoxicación durante los brotes no depende de la

densidad ni de las especies de aves afectadas, por lo que las poblaciones de especies

más abundantes y distribuidas soportan bien las pérdidas por botulismo, mientras que,

un solo brote puede tener importantes consecuencias en la viabilidad de especies en


13

peligro y/o con una distribución restringida (Rocke, 2006). Por ejemplo, en 1996

alrededor del 15-20% de la metapoblación occidental de pelícano blanco americano

(Pelecanus erythrorhynchos) murió durante un brote de botulismo (Rocke et al., 2005).

Más tarde, el botulismo mató a un número importante de ejemplares de dos especies en

peligro crítico: la espátula menor (Platalea minor) en Taiwan y el ánade de Laysán

(Anas laysanensis) en Hawaii (Chou et al., 2008; Work et al., 2010). El botulismo

también se ha asociado al declive del ánade rabudo (Anas acuta) en los Estados Unidos

(Friend et al., 2001).

Tabla 2. Ejemplos de mortalidades de aves acuáticas durante brotes botulismo (León-Vizcaíno et

al., 1979; Friend et al., 2001; Rocke, 2006; María Mójica et al., 2006; Defilippo et al., 2013)

Lugar Año Aves muertas

Utah, USA 1929 200.000

California, USA 1941 250.000

Doñana, España 1973 50.000


Firth of Forth, Gran Bretaña 1975 2.100



Mar Caspio, Rusia 1982 1.000.000

Victoria, Australia 1983 1800

La Pampa, Argentina 1996 1.300

Saskatchewan, Canadá 1996 134.000

Saskatchewan, Canadá 1997 1.000.000

Utah, USA 1997 500.000

Las Tablas de Daimiel, España 1999 10.000

El Hondo, España 2006 1400

Incheon, Corea del Sur 2008 2.000

Mar Báltico, Suecia 2000-2004 >10.000

Emilia-Romagna, Italia 2011 96


14

2.4 Epidemiologia de los brotes en humedales de agua dulce

Los brotes de botulismo tipo C o C/D ocurren principalmente en humedales de

agua dulce. Estos humedales son ecosistemas muy complejos en los que múltiples

factores físico-químicos interactúan entre si, por lo que la epidemiología del botulismo

aviar también es compleja y los brotes son difíciles de predecir y prevenir. En un

humedal se pueden dar brotes recurrentes, mientras que en los de al lado no aparecen;

además, el índice de mortalidad también varía mucho entre años.

Las esporas de C. botulinum tipo C o C/D se encuentran ampliamente

distribuidas en los sedimentos de humedales y en el aparato gastrointestinal de sus

habitantes: invertebrados, peces y aves (Rocke, 2006; Espelund y Klaveness, 2014). La

prevalencia y densidad de esporas en sedimentos varía entre estudios [de un 4,5% en la

Camarga francesa (Smith y Moryson, 1977), a un 52% en California (Sandler et al.,

1993) o un 80% en Austria (Zechmeister et al., 2005)] y no parece ser un factor

determinante ni limitante para la aparición de los brotes, porque se han dado brotes en

zonas con bajas prevalencias (Sandler et al., 1993).

2.4.1 Factores predisponentes o iniciadores

Existen varios factores ambientales que predisponen a la aparición de los brotes.

El factor más importante parece ser la temperatura del agua, sobre todo por encima de

20 ºC, acompañada de pH entre 7,5 y 9 y potencial redox negativo (Rocke y Samuel,

1999; Rocke et al., 1999; Rocke, 2006). También aumenta el riesgo de brotes el

aumento de materia orgánica y de la biomasa en agua (Rocke et al, 1999). Así, la

temperatura parece ser la fuerza que mueve muchos procesos biológicos en el sedimento

y que junto con la descomposición de la materia orgánica influye en el pH y disminuye


15

la cantidad de oxígeno disuelto y el potencial redox, permitiendo el desarrollo de C.

botulinum en el sedimento (Perez-Fuentetaja et al., 2011) (Fig. 2). Además, C.

botulinum necesita altas temperaturas para multiplicarse lo que explica que la gran

mayoría de los brotes se den en verano-otoño (Rocke y Friend, 1999).

Temperatura ambientalNivel del agua

Descomposición materia orgánica

Actividad en sedimento (bacteriana/química)

Temperatura

Oxígeno disuelto

Conductividad

Multiplicación C. botulinum

Riesgo de brote de

botulismopH=

Potencial redox Riesgo de que la

toxina pase a la cadena trófica

Fig. 2. Hipótesis sobre las condiciones ambientales que pueden producir brotes de botulismo en

los Grandes Lagos de Norte América (Pérez-Fuentetaja et al., 2011).

Una vez que C. botulinum empieza a multiplicarse en el ambiente, para que los

brotes se expandan la toxina tiene que llegar a las aves. Algunas aves como los azulones

(Anas platyrhynchos) filtran el sedimento para alimentarse y otras como los patos

cucharas (Anas clypeata) filtran la materia orgánica en descomposición del agua,

pudiendo en ambos casos ingerir la toxina durante este proceso (Rocke, 2006). También

se han descrito numerosos invertebrados (a los que las BoNTs no les afecta), plantas

acuáticas y algas como portadores de la toxina y del microorganismo (Espelund y

Klaveness, 2014). De todos estos vectores, las larvas de moscas necrófagas son las que

acumulan mayores concentraciones de toxina (Duncan y Jensen, 1976), por lo que son

las principales responsables de la propagación de los brotes a través del ciclo “larva de

mosca-cadáver” característico del botulismo aviar (ver apartado 2.4.2; Wobeser, 1997).


16

Los brotes también pueden iniciarse sin necesidad de que se produzcan

condiciones de anaerobiosis en el sedimento de los humedales. En este caso, el

desencadenante sería una mortalidad (por cualquier causa) de aves u otros animales

cuyos cadáveres contengan C. botulinum. El ambiente anaerobio y las altas

temperaturas que se dan en dichos cadáveres permiten la multiplicación y toxinogénesis

de C. botulinum en ellos, expandiéndose el brote a continuación a través del ciclo “larva

de mosca-cadáver” (Reed y Rocke, 1992). Por ejemplo, Soos y Wobeser (2006)

identifican como factor iniciador de los brotes recurrentes de botulismo en un lago

canadiense los cadáveres de pollos de una colonia de gaviotas de Franklin (Leucophaeus

pipixcan).

2.4.2 Propagación de los brotes: ciclo “larva de mosca-cadáver”

Las mayores concentraciones de toxina durante los brotes se concentran en los

cadáveres, ya que en ellos se dan las condiciones necesarias de calor, anaerobiosis y

nutricionales para el crecimiento de C. botulinum (Smith y Turner 1987; Reed y Rocke,

1992). Los invertebrados necrófagos que se alimentan de ellos, principalmente larvas de

moscas, acumulan la toxina sin ser afectados y actúan como su vehículo hacía aves

sanas que se alimentan de dichas larvas. La toxicidad de las larvas de mosca puede

llegar a 400.000 DLR/g (DLR, dosis letal para ratón) (Duncan y Jensen, 1976) y siendo

la DL50 (dosis letal para el 50% de una población expuesta) para aves de 36.000-43.000

DLR/kg, una sola larva toxica es suficiente para matar un pato (Rocke, 2006). La

mayoría de las aves no se alimenta directamente de cadáveres, pero las larvas de moscas

tienden a dispersarse (Gomes et al., 2006), momento en el que pueden ser ingeridas por

aves sanas. Tras la ingestión, las aves enferman y mueren generando nuevo sustrato


17

para el desarrollo de más C. botulinum y su toxina. Así, el ciclo se auto-perpetua (Fig.

3) hasta que las condiciones ambientales dejan de ser favorables para el crecimiento de

la bacteria o las larvas. Esto se produciría, por ejemplo cuando, se da una bajada de la

temperatura, cuando los cadáveres son eliminados por depredadores o recogidos por

hombres o cuando las aves se abandonan el humedal (Reed y Rocke, 1992; Rocke,

2006; Soos y Wobeser, 2006). Este ciclo es único entre las intoxicaciones porque la

toxina que se genera en los cadáveres produce el envenenamiento secundario de más

individuos, haciendo que la epidemiología se asemeje a la de una enfermedad infecciosa

(Wobeser, 1997). La eficacia para propagar la intoxicación por este mecanismo es muy

alta. Por ejemplo, Evelsizer et al. (2010) demostraron que los azulones (Anas

platyrhynchos) expuestos a 5-11 y >11 cadáveres/ha tenían 3,5 y 13 veces más riesgo de

morir por botulismo que los azulones que habitaban en lugares donde no había

cadáveres. Además, asociaron el riesgo de morir a la densidad de cadáveres infestados

con larvas tóxicas y no a la densidad de cadáveres sin larvas.

Fig. 3. Ciclo “larva de mosca-cadáver” por el cual los brotes de botulismo aviar se propagan

exponencialmente.


18

2.5 Sintomatología y diagnóstico del botulismo aviar

Los brotes se caracterizan por la aparición de un gran número de aves de

diferentes especies (Fig. 4) muertas o enfermas en la orilla de los humedales (Rocke y

Friend, 1999). Normalmente, las mortalidades ocurren en épocas estivo-otoñales cuando

las temperaturas ambientales son altas. Las aves enfermas presentan síntomas de

parálisis flácida ascendente: se propulsan con las alas por el agua, sufren parálisis de la

membrana nictitante o tercer párpado, y en estadios más avanzados parálisis del cuello

(Fig. 4) y muerte, bien porque se ahogan o por parada cardio-respiratoria. La necropsia

de las aves muertas no muestra lesiones características, y estas suelen presentar un buen

estado nutricional y el estómago vacío (Rocke y Friend, 1999; Rocke, 2006).

Fig. 4. Varias especies de aves muertas recogidas durante un brote de botulismo en la Laguna de

Navaseca (Daimiel, Ciudad Real) en 2010 (Imagen de la izquierda, tomada por Rafael Mateo).

Parálisis flácida del cuello en un azulón afectado por botulismo (imagen de la derecha, tomada

por Elena Crespo).

El diagnóstico del botulismo en aves acuáticas se basa en los signos de campo y

la sintomatología clínica de las aves afectadas, anteriormente descrita. Además, se debe


19

confirmar la presencia de la toxina botulínica en la sangre de varios ejemplares

afectados para descartar otras posibles causas de mortalidad de aves acuáticas silvestres

como: intoxicaciones por biotoxinas de algas u otros tóxicos (por ejemplo

organoclorados) y enfermedades infecciosas de tipo bacteriano o vírico (Rocke y

Friend, 1999; Sonne et al., 2012). La toxina en sangre se detecta mediante el bioensayo

en ratón y la identificación del tipo de BoNT causante del brote se realiza con las

antitoxinas C, D o E (normalmente implicadas en el botulismo aviar). Alternativamente,

para la detección de las toxinas tipo C y/o D en sangre, tejidos y heces de aves, se han

publicado varios ensayos de ELISA (Thomas, 1991; Rocke et al., 1998; Zechmeister et

al., 2005), pero ninguno ha remplazado al bioensayo. También se ha publicado un

protocolo de espectrofotometría de masas para la detección de toxinas C y D en suero e

hígado de aves con buenos resultados de sensibilidad (Hedeland et al., 2011).

Actualmente, la técnica más usada para el estudio del botulismo aviar es la PCR.

Como se ha comentado anteriormente esta técnica no está indicada para el diagnóstico

individual, pero lo apoya. Por otra parte es un método de elección para estudios

epidemiológicos y existen varios protocolos de PCR convencional (Franciosa et al.,

1996; Prévot et al., 2007), anidada (Williamson et al., 1999) y a tiempo real (Sánchez-

Hernández et al., 2008; Lindberg et al., 2010; Anniballi et al., 2011) para la detección

de los genes que codifican las neurotoxinas tipo C y D en muestras ambientales y de

tejidos de animales. También existen PCR específicas para detectar los genes de los

mosaicos C/D y D/C (Takeda et al., 2005; Woudstra et al., 2012).


20

2.6 Medidas de control

Clostridium botulinum es una bacteria ubicua que se encuentra en el ambiente,

especialmente en sedimentos de los humedales y en el tracto gastrointestinal de sus

habitantes, por lo que eliminarla, en principio, es imposible. Además, la prevención de

los brotes es muy difícil dada la compleja epidemiología de esta enfermedad que los

hace impredecibles. Por eso, en líneas generales se han propuesto varias medidas para

reducir las pérdidas por botulismo, aunque no existen muchos estudios sobre su eficacia

(Rocke y Friend, 1999; Cromie et al., 2012). Algunas de estas medidas son las

siguientes:

Documentar las condiciones ambientales, localizar zonas donde se dan brotes

más frecuentemente y registrar en qué fechas para identificar zonas de riesgo

donde implantar sistema de vigilancia y retirada de cadáveres. La vigilancia de

estos puntos debe comenzar entre 10 y 15 días antes de las fechas de riesgo y

terminar entre 10 y 15 días después de la “época de botulismo” para evitar que

se desencadene el ciclo “larva de mosca-cadáver”.

Evitar cambios bruscos en el nivel del agua en los meses calurosos, ya que estos

pueden causar la muerte de invertebrados y peces que aportarán materia

orgánica para el desarrollo inicial de C. botulinum en sedimentos.

Construir humedales accesorios al lado de humedales de riesgo para evacuar a

las aves en caso de brote (desecando los humedales afectados).

Reducir la entrada de materia orgánica (como puede ser la procedente de aguas

residuales) en los humedales, particularmente en meses cálidos.

Oxigenar el agua, por ejemplo, mejorando el flujo de agua.


21

Recoger todos los cadáveres de vertebrados, especialmente durante los brotes,

enterrarlos y quemarlos. También vigilar que no se acumulen cadáveres en zonas

de aguas someras importantes para limícolas.

Evitar causas de mortalidad externas como líneas de alta tensión cerca de

humedales con muchas aves, dado que pueden matar suficiente número de

animales para comenzar un brote por el ciclo “larva de mosca-cadáver”.

Otros autores han recomendado medidas como quitar la vegetación muerta para

evitar acumulación de materia orgánica, agitar el agua estancada o crear orillas con

bordes profundos (para evitar el calentamiento del agua). De todas estas

recomendaciones, solamente la retirada de cadáveres ha demostrado ser efectiva (Reed

y Rocke, 1992). Aún así, esta estrategia es costosa y no previene los brotes, además, la

eficacia de esta medida varía según las características del humedal. En humedales

grandes con mucha vegetación e islas es más difícil encontrar los cadáveres y un único

cadáver tóxico puede ser suficiente para matar un gran número de aves sanas. En un

estudio elaborado por Cliplef y Wobeser (1993) se estimó que sólo se llegaba a recoger

un 32% de los cadáveres.

Actualmente en Castilla-La Mancha se han establecido dos tipos de medidas de

prevención. Por un lado, en el caso de la Laguna de la Veguilla en Alcázar de San Juan,

donde los brotes de botulismo eran muy frecuentes, la laguna se deja desecar

naturalmente en verano vertiendo el agua de la depuradora (que la abastece la mayor

parte del año) a la junta de los ríos Záncara y Cigüela. Esta medida ha dado buenos

resultados porque no se registran brotes desde el año 2008. Por otro lado, en la zona del

Parque Natural de las Tablas de Daimiel y en concreto en la laguna de Navaseca, donde

los brotes son recurrentes, la guardería del Parque y la Junta de Comunidades de

Castilla la Mancha y personal contratado por el Ayuntamiento de Daimiel prospectan


22

las orillas y retiran todos los animales muertos o enfermos que encuentran durante la

época de riesgo de botulismo.

2.7 El botulismo aviar en España

El botulismo aviar es una enfermedad endémica en España donde se registran

brotes prácticamente todos los veranos, tanto en el norte como en el sur. Los primeros

brotes de botulismo descritos datan de 1973 y 1974 en las Marismas del Guadalquivir

(Parque Nacional de Doñana) y alrededores. Durante el periodo estival de estos años se

retiraron 50.000 aves acuáticas muertas el primer año y 15.000 el segundo, de más de

una veintena de especies. A partir de entonces, a lo largo de los años 70 y 80, se

registraron brotes en esa zona casi anualmente. En los veranos de 1975 y 1977 estas

mortalidades se asocian por primera vez a C. botulinum tipo C mediante el bioensayo en

ratón (León-Vizcaíno et al., 1979). En 1978 se registró también en esta zona uno de los

brotes más graves ocurridos en España con alrededor de 70.000 aves afectadas. Este

brote fue relacionado con la desecación natural de las marismas (las aguas poco

profundas pueden ser un factor de riesgo) y la contaminación proveniente del río

Guadalquivir. Posteriormente, en 1983, ante la amenaza de que un brote acabase con las

últimas Malvasías cabeciblancas (Oxyura leucocephala) de la población española, que

estaba en proceso de recuperación (actualmente la población es más abundante y

distribuida, con alrededor de 2.000 ejemplares censados en 2013), se investigó la

presencia de C. botulinum en 3 lagunas cordobesas donde habitaban dichos ejemplares.

Ninguna de esas tres lagunas tenía historia de brotes ni se encontró el patógeno en el

sedimento (Contreras de Vera et al., 1987). Así, durante los años 80 se realizaron varios

estudios sobre botulismo aviar en lagunas andaluzas (donde los brotes eran frecuentes),


23

principalmente sobre prevalencia del patógeno en sedimentos y para intentar localizar

zonas de riesgo. Las prevalencias encontradas variaron entre un 53% en sedimentos

positivos en una laguna de Sevilla y un 1,7% en las Marismas de Odiel (Contreras de

Vera et al., 1987; Contreras de la Vera et al., 1989; García et al., 1992). Otro humedal

español donde se registran brotes frecuentes de botulismo es el embalse de Hondo,

situado al sureste de la provincia de Alicante. Por ejemplo, durante el verano de 2006 un

brote afecto a 1.800 aves (1.200 muertas y 600 vivas) de 25 especies diferentes, de las

enfermas, se recuperó un 67% (María-Mojica et al., 2006). En los humedales castellano-

manchegos esta enfermedad también es endémica y el brote más grave ocurrió en Las

Tablas de Daimiel en 1999 donde se recogieron más de 10.000 aves muertas.

3. Pérdida de humedales: el caso de la reserva de la Biosfera de la

Mancha-Húmeda

Los humedales son áreas donde el agua es el principal factor que controla el

medio ambiente, sus plantas y animales asociados. Según el Convenio Ramsar (tratado

internacional que sirve de marco para la conservación de los humedales), los humedales

se definen como “áreas de marisma, pantano, turbera o con agua, ya sea natural o

artificial, permanente o temporal, con agua estática o en movimiento, fresca, salobre o

salada, incluyendo aguas marinas cuya profundidad no exceda los 6 metros”. Los

humedales se encuentran entre los ecosistemas más productivos del mundo dado que

aportan agua y productividad primaria de la que dependen miles de especies de plantas

y animales (Ramsar, 2009).

Globalmente, estos ecosistemas están desapareciendo y con ellos muchas

poblaciones de aves acuáticas están experimentando serios declives. En 2008, el 17% de


24

las especies de aves acuáticas estaban consideradas globalmente amenazadas y en 2006,

un estudio indicó que el 40% de las 1.200 poblaciones de aves acuáticas de las que se

conocía su tendencia estaban en declive y sólo el 17% en aumento (Birdlife, 2008a). La

intensificación y expansión de la agricultura y crecimiento descontrolado están entre las

mayores amenazas (Birdlife, 2004a). Por ejemplo, en las llanuras de Sanjiang (China) se

ha perdido alrededor del 70% de las 3,5 millones de ha de zonas húmedas con la

consecuente pérdida de biodiversidad y degradación del medio (Song et al., 2014). Las

presas, embalses y puertos también afectan a una alta proporción de los sistemas

fluviales, con la consiguiente pérdida de humedales (Birdlife, 2008a) y la

contaminación generada por la agricultura y la industria está causando la degradación de

un alto número de ellos (Birdlife, 2008b). Por último, el cambio climático está alterando

los ciclos hidrológicos y la vegetación de algunos humedales (Werner et al., 2013).

En la zona de la Mancha Húmeda (25.000 ha), donde se desarrollan los estudios

de esta tesis, también se ha producido una importante pérdida de humedales en los

últimos 60 años. Esta región se localiza en la cuenca alta del río Guadiana (Castilla-La

Mancha) y fue denominada Reserva de la Biosfera en 1980 por la UNESCO. El

humedal más representativo son Las Tablas de Daimiel en Ciudad Real, que fue

declarado Parque Nacional en 1973, precisamente con la intención de proteger dicho

humedal con sus aves acuáticas de la desecación debida a la Ley del 17 de julio de 1956

sobre “Saneamiento y colonización de los terrenos pantanosos que se extienden

inmediatos a las márgenes de los ríos Guadiana, Cigüela y Záncara y afluentes”.

Posteriormente, en 1982 el parque fue incluido en la lista Ramsar de humedales de

importancia internacional y en 1988 fue declarado Zona de Especial Protección para las

Aves (ZEPA). Este humedal, representativo de los humedales de zonas semiáridas, es

una llanura de inundación formada en la confluencia del río Cigüela (agua salina) y el


25

Guadiana (agua dulce) y también es zona de descarga del acuífero 23. Esta región, y en

concreto Las Tablas de Daimiel, era importante por el gran número de especies de aves

acuáticas y flora palustre que albergaba, de especial importancia el pato colorado (Netta

ruffina), símbolo del parque, y la masiega (Cladium mariscus) (Pérez et al., 2001;

Álvarez-Cobelas et al., 2001).

Del total de las 6.000 ha que cubrían Las Tablas hace 60 años, actualmente

quedan protegidas 1.928 ha. La degradación de las zonas húmedas en esta región

comenzó en los años 50 con la desecación de humedales para evitar malaria y conseguir

más tierras para la agricultura (Pérez et al., 2001), así en estos años se desecaron

alrededor del 70% de las zonas húmedas de La Mancha Húmeda (Fornés et al., 2000) y

la superficie del Las Tablas se redujo a 1/7 (Álvarez-Cobelas et al., 2001).

Posteriormente, el problema se agravó a partir de los 70 cuando las nuevas tecnologías

permitieron la extracción de agua subterránea por medio de bombas de extracción para

la irrigación, y se produjo un aumento incontrolado de pozos. Así, de las 30.000 ha que

estaban dedicadas a la irrigación en 1960 se pasó a 150.000 en el 2003. Entre 1970 y

1990 el nivel del acuífero bajó a razón de 1 m/año, llegando a perderse alrededor de 22

metros. Este proceso permitió el desarrollo económico de la zona pero también acabo

con gran parte de los humedales que quedaban y su biodiversidad. (Martínez-Santos et

al., 2008). Además, durante los años 90 se alternaron periodos de sequía extrema

(típicos de la zona) que empeoraron la situación. Esta sobreexplotación resultó en la

degradación de los humedales superficiales y arroyos que se alimentaban del acuífero,

se alteró el curso y cauce de los ríos, e incluso se produjo la combustión espontanea de

la turba (Martínez-Santos et al., 2008). A estos problemas de escasez hay que añadir

que, debido al desarrollo agrícola e industrial, la contaminación orgánica de aguas

superficiales y subterráneas aumentó considerablemente hasta que se instalaron


26

depuradoras en los años 80 (Martínez-Santos et al., 2008). En 1980 se declaró el

acuífero sobreexplotado y se intentaron tomar medidas para la recuperación de las

Tablas de Daimiel. En principio estas medidas estaban dedicadas a mantener la lámina

de agua y las poblaciones de aves acuáticas: se transvasó agua de la cuenca del Tajo, se

construyeron presas para retener el agua de Las Tablas e incluso se bombeó agua

subterránea. Más tarde se intentó recuperar el acuífero, verdadero problema de la falta

de agua, prohibiendo crear nuevos pozos y controlando el número de los existentes

(legales e ilegales). La eficacia de estas medidas ha sido cuestionada (Martínez-Santos

et al., 2008), aunque parece que en los últimos años el Parque Nacional y el acuífero se

han regenerado en gran medida, en parte debido a un periodo de abundantes lluvias. En

la figura 5 se muestra la evolución temporal de la profundidad de la lámina de agua del

acuífero en relación a estos acontecimientos. Una de las últimas medidas estudiadas

para el mantenimiento del Las Tablas de Daimiel ha sido la de mantener el nivel hídrico

con aguas residuales urbanas tratadas (Navarro et al., 2011), aunque se debe estudiar las

consecuencias que podría tener esta acción en un ecosistema tan singular. Actualmente

la mayoría de los humedales restantes y cauces de río de la reserva están protegidos.


27

Fig. 5. Evolución de la profundidad de lámina de agua (nivel del acuífero) hasta el 2005 en

relación a las políticas medioambientales y otros acontecimientos importantes del momento

(gráfica tomada de Martínez-Santos et al., 2008).

3.2 Las aves acuáticas y los humedales de aguas residuales

Debido a la pérdida global de humedales naturales, las aves acuáticas se están

volviendo cada vez más dependientes de hábitats artificiales como humedales

abastecidos con aguas residuales (Murray y Hamilton, 2010; Orlowski, 2013). Algunos

de estos humedales están reconocidos como zonas importantes para las aves (ZEPAs).

Por ejemplo, las lagunas de tratamiento de aguas residuales de Phakalane en Botswana

(Birdlife, 2014a), el Western Treatment Plant en Mebourne (Murray y Hamilton, 2010;

Birdlife 2014b) o las estaciones de aguas residuales de Wroclaw en Polonia (Orlowski,

2013). En determinados lugares, este tipo de humedales sostienen poblaciones de

especies de aves acuáticas amenazadas, como es el caso de las población reproductora


28

de Malvasía cabeciblanca en la Mancha, que cría en varias lagunas asociadas a

depuradoras como la laguna de Navaseca, en Daimiel o la laguna del Pueblo, en Pedro

Muñoz, o la población invernante, también de Malvasía cabeciblanca, en Israel (Hadad

y Moyal, 2007). Además, la importancia de estos humedales podría aumentar dado que

en países en vías de desarrollo, donde actualmente se pierden más zonas húmedas, se

está promoviendo su uso para el saneamiento de las aguas residuales (Kiviasi, 2001). El

problema es que hay poca información sobre cómo construir y/o manejar este tipo de

humedales “artificiales” con el propósito de conservar las aves acuáticas, por lo que

podrían entrañar riesgos para ellas, sobretodo sanitarios, dado que las aguas residuales

pueden aportar contaminación química, como compuestos orgánicos bromados o

disruptores endocrinos, y/o biológica, como enterobacterias (Markman et al., 2008;

Okafor, 2011; Gilchrist et al., 2014).

Muchos de los humedales de La Mancha Húmeda reciben vertidos de origen

urbano de forma habitual, en su mayoría procedentes de depuradoras, con mayor o

menor nivel de eficacia (Sánchez, 2013). Por un lado, estos aportes mantienen los

niveles hídricos y aumentan la carga orgánica del agua (dado que aportan mucho

nitrógeno y fósforo que permite el crecimiento del fitoplancton), lo que inicialmente

favorece a las aves acuáticas, pero también aportan contaminación, química y biológica,

y producen la eutrofización de las aguas (Pérez et al., 2001; Okafor, 2011) que a largo

plazo les puede perjudicar. Por ejemplo, humedales protegidos como las lagunas del

Pueblo, Longar, Manjavacas, Larga, Pozo de la Puerta, Navaseca, Alcázar o la

Inesperada, reciben aguas residuales (Pérez et al., 2001). Como se ha comentado en el

apartado 2.4.1. “Factores predisponentes o iniciadores” las mortalidades de aves por

otras causas pueden desencadenar los brotes de botulismo (Murphy et al., 2000; Soos y

Wobeser, 2006), ya que los cadáveres son el sustrato ideal para la multiplicación de C.


29

botulinum tipo C/D con la consecuente producción de toxina. En este sentido, bacterias

comunes en aguas residuales como C. perfringens tipo A, Escherichia coli patógena

para las aves (APEC) o Sallmonella spp. (Skanavis y Yanko, 2001; Sahlström et al.,

2004; Okafor, 2011) pueden causar la muerte de aves (Benskin et al., 2009), lo que

aumentaría el riesgo de brotes de botulismo en los humedales abastecidos con aguas

residuales o incluso en Las Tablas de Daimiel en el caso de que se inundasen

artificialmente con este tipo de aguas para paliar los efectos de sequías. También se ha

sugerido que las aguas residuales pueden ser un factor de riesgo de botulismo aviar

porque aumentan la biomasa de invertebrados acuáticos y pueden alterar otras

características físico-quimicas de las aguas que favorezcan el establecimiento y

proliferación de C. botulinum, aunque no existen evidencias (Murray y Hamilton,

2010). Dado el riesgo que conlleva el uso de aguas residuales tratadas para la

conservación de humedales, se evidencia que son necesarios más estudios sobre los

efectos adversos que el vertido de estas aguas pueda tener sobre ellos y sobre la sanidad

de las aves acuáticas que los habitan, incluyendo el riesgo de botulismo aviar que es una

de las enfermedades que afecta a más especies y causa más bajas. La presente tesis tiene

el objetivo de abordar precisamente algunos de estos aspectos de la ecología del

botulismo aviar en humedales abastecidos con aguas residuales tratadas.

Referencias

Anniballi, F., Auricchio, B., Delibato, E., Antonacci, M., De Medici, D., Fenicia, L.

2012. Multiplex real-time PCR SYBR Green for detection and typing of group

III Clostridium botulinum. Veterinary Microbiology 154, 332e8.


30

Álvarez-Cobelas, M., Cirujano, S., Sánchez-Carrillo, S. 2001. Hydrological and

botanical man-made changes in the Spanish wetland of Las Tablas de Daimiel.

Biological Conservation 97, 89-98.

Arnon, S.A., Schecter, R., Inglesby, T.V., Henderson, D. A., Bartlett, J. G., Ascher, M.

S., Eitzen, E., Fine, A. D., Hauer, J., Layton, M., Lillibridge, S., Osterholm,

M.T., O’Toole, T., Parker, G., Perl, T. M., Russell, P.K., Swerdlow, D.L., Tonat,

K. 2001. Botulinum toxin as a biological weapon: medical and public health

management. JAMA 285, 1059–1070.

Benskin, C.M., Wilson, K., Jones, K., Hartley, I.R. 2009. Bacterial pathogens in wild

birds: a review of the frequency and effects of infection. Biological Reviews 84,

349-373.

Bernard, W., Divers, T.J., Whitlock, R.H., Messick, J., Tulleners, E. 1987. Botulism as

a sequel to open castration in a horse. Journal of the American Veterinary

Medical Association 191, 73-4.

BirdLife International. 2004a. Agricultural intensification threatens Important Bird

Areas in Europe. Presented as part of the BirdLife State of the world's birds

website. Disponible en: http://www.birdlife.org/datazone/sowb/casestudy/140.

Consultado: 19/08/2014

BirdLife International. 2004b. Large dams and barrages are an increasing threat to

wetland-dependent birds. Presented as part of the BirdLife State of the world's

birds website. Disponible en:

http://www.birdlife.org/datazone/sowb/casestudy/150. Consultado: 19/08/2014

BirdLife International. 2008a. Waterbirds are showing widespread declines, particularly

in Asia. Presented as part of the BirdLife State of the world's birds website.


31

Disponible en: http://www.birdlife.org/datazone/sowb/casestudy/71. Consultado:

12/08/2014.

BirdLife International. 2008b. Pollution from agriculture, forestry and industry has

significant impacts on birds. Presented as part of the BirdLife State of the

world's birds website. Available from:

http://www.birdlife.org/datazone/sowb/casestudy/155. Checked: 21/08/2014

BirdLife International. 2014a. Important Bird Areas factsheet: Phakalane sewage

lagoons, near Gaborone. Disponible en: http://www.birdlife.org. Consultado:

13/08/2014

BirdLife International. 2014b. Important Bird Areas factsheet: Werribee and Avalon.

Disponible en: http://www.birdlife.org. Consultado: 13/08/2014

Breidenbach, M.A., Brunger, A.T. 2005. New insights into clostridial neurotoxin–

SNARE interactions. TRENDS in Molecular Medicine 11, 377-381.

Centers for Disease Control and Prevention (CDC): Botulism in the United States,

1899-1996. 1998. Handbook for Epidemiologists, Clinicians, and Laboratory

Workers, Atlanta, GA. Centers for Disease Control and Prevention. Descarga

PDF: http://www.cdc.gov/ncidod/dbmd/diseaseinfo/files/botulism.PDF

Chou, S.J., Shieh, Y.C., Yu, C.Y. 2008. Hematologic and biochemistry values for

black-faced spoonbills (Platalea minor) with and recovering from botulism.

Journal of Wildlife Diseases 3, 781-784.

Cliplef, D.J., Wobeser, G. 1993. Observations on waterfowl carcasses during a botulism

epizootic. Journal of Wildlife Diseases 29, 8-14.

Collins, M.D., East, A.K. 1998. Phylogeny and taxonomy of the food-borne pathogen

Clostridium botulinum and its neurotoxins. Journal of Applied Microbiology 84,

5-17.

http://www.birdlife.org/

http://www.birdlife.org/

http://www.cdc.gov/ncidod/dbmd/diseaseinfo/files/botulism.PDF


32

Contreras de Vera, A., León, L., Carranza, J., Hermoso de Medoza, M., Garrido, F.

1987. Botulismo aviar en zonas húmedas de la campiña de Sevilla y Córdoba.

Medicina Veterinaria 4, 173-180.

Contreras de Vera, A., León, L., Cubero, M.J. 1989. Distribución de esporos botulínicos

en lagunas andaluzas. Oxyura 5, 119-126.

Cromie, R.L., Lee, R., Delahay, R.J., Newth, J.L., O’Brien, M.F., Fairlamb, H.A.,

Reeves, J.P., Stroud, D.A. 2012. Ramsar Wetland Disease Manual: Guidelines

for Assessment, Monitoring and Management of Animal Disease in Wetlands.

Ramsar Technical Report No. 7. Ramsar Convention Secretariat, Gland,

Switzerland.

Defilippo, F., Luppi, A., Maioli, G., Marzi, D., Fontana, M.C., Paoli, F., Bonilauri, P.,

Dottori, M., Meriald, G. 2013. Outbreak of type C botulism in birds and

mammals in the Emilia Romagna region, Northern Italy. Journal of Wildlife

Diseases 49, 1042–1046.

Duncan, R.M., Jensen, W.L. 1976. A relationship between avian carcasses and living

invertebrates in the epizootiology of avian botulism. Journal of Wildlife

Diseases 12, 116–126.

Eklund, M.W., Poysky, F.T. 1974. Interconversion of type C and D strains of

Clostridium botulinum by specific bacteriophages. Applied Microbiology, 27,

251-258.

Eklund, M.W., Poysky, F.T., Meyers, J.A., Pelroy, G.A. 1974. Interspecies conversion

of Clostridium botulinum type C to Clostridium novyi type A by bacteriophage.

Science 186, 456-458.

Ekong, T. 2000. Immunological detection of botulinum neurotoxins. Anaerobe 6, 125–

127.


33

Espelund, M., Klaveness, D. 2014. Botulism outbreaks in natural environments – an

update. Frontiers in Microbiology (ecollections) 5, 287, 1-7.

Evelsizer, D.D., Clark, R.G., Bollinger, T.K. 2010. Relationships between local carcass

density and risk of mortality in molting mallards during avian botulism

outbreaks. Journal of Wildlife Diseases 46, 507-13.

Fornés, J., Rodriguez, J.A., Hernández, N., Llamas, M.R. 2000. Possible solutions to

avoid conflicts between water resources development and wetland conservation

in the "La Mancha Húmeda" Biosphere Reserve (Spain) Physics and Chemistry

of the Earth, Part B: Hydrology, Oceans and Atmosphere 25, 623-627.

Franciosa, G., Fenicia, L., Caldiani, C., Aureli, P. 1996. PCR for detection of

Clostridium botulinum type C in avian and environmental samples. Journal of

Clinical Microbiology 34, 882–885.

Friend, M., McLean, R.G., Dein, F.J. 2001. Disease emergence in birds: challenges for

the twenty-first century. The Auk 118, 290-303.

García, A., León, L., Cubero, M.J., Contreras de Vera, A. 1992. Sobre la baja

prevalencia de Clostridium botulinum en humedales de las marismas de Odiel

(Huelva). Oxyura 6, 49-51.

Gilchrist, T.T., Letcher, R.J., Thomas, P., Fernie, K.J. 2014. Polybrominated diphenyl

ethers and multiple stressors influence the reproduction of free-ranging tree

swallows (Tachycineta bicolor) nesting at wastewater treatment plants. Science

of the Total Environment 472, 63–71.

Gomes, L., Conde, W.A., Von Zuben, C.J. 2006. A review of postfeeding larval

dispersal in blowflies: implications for forensic entomology.

Naturwissenschaften 93, 207-215.


34

Hadad, E., Moyal, C. 2007. Preference of the White-headed duck Oxyura leucocephala

for wastewater reservoirs in the Judean Plain, Israel. Sandgrouse 29, 70-78.

Hedeland, M., Moura, H., Båverud, V, Woolfitt, A.R., Bondesson, U., Barr, J.R. 2011.

Confirmation of botulism in birds and cattle by the mouse bioassay and

Endopep-MS. Journal of Medical Microbiology 60, 1299–1305.

Hill, K.K., Smith, T.J., Helma, C.H., Ticknor, L.O., Foley, B.T., Svensson, R.T.,

Brown, J.L., Johnson, E.A., Smith, L.A., Okinaka, R.T., Jackson, P.J., Marks,

J.D. 2007. Genetic diversity among botulinum neurotoxin-producing clostridial

strains. Journal of Bacteriology 189, 818-832.

Kalb, S.R., Moura, H., Boyer, A.E., McWilliams, L.G., Pirkle, J.L., Barr, J.R. 2006.

The use of Endopep-MS for the detection of botulinum toxins A, B, E, and F in

serum and stool samples. Analytical Biochemistry 351, 84–92.

Kivaisi, A.K. 2001. The potential for constructed wetlands for wastewater treatment and

reuse in developing countries: a review. Ecological Engineering 16, 545–560.

León-Vizcaíno, L., Miranda, A., Carranza, J., Perea, A. 1979. Intoxicación botulínica en

aves acuáticas silvestres en la marisma del Guadalquivir (Coto Doñana). Acta

Vertebrata 6, 120-123.

Lindberg, A., Skarin, H., Knutsson, R., Blomqvist, G., Båverud, V. 2010. Real-time

PCR for Clostridium botulinum type C neurotoxin (BoNTC) gene, also covering

a chimeric C/D sequence-application on outbreaks of botulism in poultry.

Veterinary Microbiology 146, 118-123.

Liguori, V., De Iuliis, P., Fenicia, L., Anniballi, F., Aureli, P. 2008. A case of wound

botulism in a foal affected by gastric ulcers in Italy. Journal of Equine

Veterinary Science 28, 476–478.


35

Lindström, M., Korkeala, H. 2006. Laboratory diagnostics of botulism. Clinical

Microbiology Reviews 19, 298–314.

Lindström, M., Nevas, M., Kurki, J., Sauna-aho, R., Latvala-Kiesilä, A., Pölönen, I.,

Korkeala, H. 2004. Type C botulism due to toxic feed affecting 52,000 farmed

foxes and minks in Finland. Journal of Clinical Microbiology 42, 4718-4725.

María-Mojica, P., Mateo, P., Izquierdo, A., Ferrández, M., Morán, S., Rubio, F.,

Gerique, C., Echevarrias, J.L., Sánchez, J.A., García-Fernández, A. J. 2006.

Control de un brote de botulismo en el Parque Natural “El Hondo” (Alicante).

Jornadas Ibéricas de Centros de Recuperación, GREFA, CosmoCaixa Madrid 2,

3 y 4 de Noviembre.

Markman, S., Leitner, S., Catchpole, C., Barnsley, S., Müller, C.T., Pascoe, D.,

Buchanan, K.L. 2008. Pollutants increase song complexity and the volume of the

brain area HVC in a songbird. PLoS ONE 3: e1674.

doi:10.1371/journal.pone.0001674.

Martínez-Santos, P., De Stefano, L., Llamas, M.R., Martínez-Alfaro, P.E. 2008.

Wetland restoration in the Mancha occidental aquifer, Spain: A critical

perspective on water, agricultural, and environmental policies. Restoration

Ecology 16, 511-521.

Midura, T.F. 1996. Update: infant botulism. Clinical Microbiology Reviews 9, 119-125.

Miyazaki, S., Sakaguchi, G. 1978. Experimental botulism in chickens: the cecum as the

site of production and absorption of botulinum toxin. Japanese Journal of

Medical Science and Biology 31, 1-15.

Moriishi, K., Koura, M., Abe, N., Fujii, N., Fujinaga, Y., Inoue, K., Oguma, K. 1996.

Mosaic structures of neurotoxins produced from Clostridium botulinum types C

and D organisms. Biochimica et Biophysica Acta 1307, 123–126.


36

Murphy, T., Lawson, A., Nalewajko, C., Murkin, H., Ross, L., Oguma, K., McIntyre, T.

2000. Algal toxins—Initiators of avian botulism? Environmental Toxicology 15,

558-67.

Murray, C.G., Hamilton, A.J. 2010. Perspectives on wastewater treatment wetlands and

waterbird conservation. Journal of Applied Ecology 47, 976–985.

Navarro, V., García, B., Sánchez, D., Asensio, L. 2011. An evaluation of the application

of treated sewage effluents in Las Tablas de Daimiel National Park, Central

Spain. Journal of Hydrology 401, 53-64.

Okafor, N. 2011. Pollution of aquatic systems: Pollution through eutrophication, fecal

materials, and oil spills. In Environmental Microbiology of Aquatic and Waste

Systems, Springer, Netherlands. p 151-183.

Orłowski, G. 2013. Factors affecting the use of waste stabilization ponds by birds: A

case study of conservation implications of a sewage farm in Europe. Ecological

Engineering 61, 436–445.

Peck, M.W., Stringer, S.C., Carter, A.T. 2011. Clostridium botulinum in the post

genomic era. Food Microbiology 28, 183-91.

Pérez, M., Aramburu, M.J., González, J.L. (Eds). 2001. Reserva de la Biosfera de La

Mancha-Húmeda: retos y oportunidades de futuro. Ministerio de Medio

Ambiente y Medio Rural y Medio Marino y la Comunidad Autónoma de

Castilla-La Mancha Descargable en:

http://pagina.jccm.es/medioambiente/planes_programas/reservabiosfera_mancha

_humeda.pdf

Pérez-Fuentetaja, A., Clapsadl, M.D., Getchell, R.G., Bowser, P.R., Lee, W.T. 2011.

Clostridium botulinum type E in Lake Erie: inter-annual differences and role of

benthic invertebrates. Journal of the Great Lakes Research 37, 238–244.

http://pagina.jccm.es/medioambiente/planes_programas/reservabiosfera_mancha_humeda.pdf

http://pagina.jccm.es/medioambiente/planes_programas/reservabiosfera_mancha_humeda.pdf


37

Popoff, M.R. 1995. Ecology of neurotoxigenic strains of clostridia. In: Montecucco, C.

(Ed). Clostridial neurotoxins. Springer Verlag Berlin and Heidelberg pp 161-

195.

Prévot, V., Tweepenninckx, F., Van Nerom, E., Linden, A., Content, J., Kimpe, A.

2007. Optimization of polymerase chain reaction for detection of Clostridium

botulinum type C and D in bovine samples. Zoonoses and Public Health. 54,

320–327.

Ramsar, 2009. What are wetlands? Consultado el 19 de Agosto del 2014:

http://www.ramsar.org/cda/es/ramsar-about-faqs-

whatarewetlands/main/ramsar/1-36-37%5E7713_4000_2__

Reed, T.M., Rocke, T.E. 1992. The role of avian carcasses in botulism epizootics.

Wildlife Society Bulletin 20, 175-182.

Rocke, T.E. 2006. The global importance of avian botulism. In Boere, G.C., Galbraith,

C.A., Stroud, D.A. (eds) Waterbirds around the world. The Estationery Office:

Edinburg, UK. pp. 422-426.

Rocke, T.E., Converse, K., Meteyer, C.U., McLean, B. 2005. The impact of disease in

the American White Pelican in North America. Waterbirds 28, 87-94.

Rocke, T.E., Euliss, N.H. Jr., Samuel, M.D. 1999. Environmental characteristics

associated with the occurrence of avian botulism in wetlands of a Northern

California refuge. Journal of Wildlife Management 63, 358-368.

Rocke, T.E., Friend, M. 1999. Avian botulism. In Friend, M., Franson, J.C (eds). Field

manual of wildlife diseases: general field procedures and diseases of birds.

Washington, D.C.: U.S. Dept. of the Interior, U.S. Geological Survey. pp. 271-

282.

http://www.ramsar.org/cda/es/ramsar-about-faqs-whatarewetlands/main/ramsar/1-36-37%5E7713_4000_2__

http://www.ramsar.org/cda/es/ramsar-about-faqs-whatarewetlands/main/ramsar/1-36-37%5E7713_4000_2__


38

Rocke, T.E., Samuel, M.D. 1999. Water and sediment characteristics associated with

avian botulism outbreaks in wetlands. Journal of Wildlife Management 63,

1249-1260.

Rocke, T.E., Smith, S.R., Nashold, S.W. 1998. Preliminary evaluation of a simple in

vitro test for the diagnosis of type C botulism in wild birds. Journal of Wildlife

Diseases 34, 744-751.

Rossetto, O., Pirazzini, M., Montecucco, C. 2014. Botulinum neurotoxins: genetic,

structural and mechanistic insights. Nature Reviews Microbiology 12, 535-49.

Sakaguchi, Y., Hayashi, T., Kurokawa, K., Nakayama, K., Oshima, K., Fujinaga, Y.,

Ohnishi, M., Ohtsubo, E., Hattori, M., Oguma, K. 2005. The genome sequence

of Clostridium botulinum type C neurotoxin-converting phage and the molecular

mechanisms of unstable lysogeny. Proceedings of the National Academy of

Sciences of the USA 102, 17472-17477.

Sánchez, D. 2013. Diseño y modelización de humedales para el tratamiento de efluentes

de depuradora. Aplicación en el entorno del Parque Nacional de la Tablas de

Daimiel. Tesis doctoral. Universidad de Castilla la Mancha, Ciudad Real,

España.

Sánchez-Hernández, L., Cifuentes, A., Jiménez, B., Mateo, R., González, R. 2008.

Detection of Clostridium botulinum neurotoxin coding genes: analysis of PCR

products by real time versus capillary gel electrophoresis methods. European

Food Research and Technology 227, 495–502.

Sandler, R.J., Rocke, T.E., Samuel, M.D., Yuill, T.M. 1993. Seasonal prevalence of

Clostridium botulinum type C in sediments of a northern California wetland.



39

Sahlström, L., Aspan, A., Bagge, E., Danielsson-Tham, M.L., Albihn, A. 2004.

Bacterial pathogen incidences in sludge from Swedish sewage treatment plants.

Water Research 38, 1989-1994.

Skanavis, C., Yanko, W.A. 2001. Clostridium perfringens as a potential indicator for

the presence of sewage solids in marine sediments. Marine Pollution Bulletin 42,

31-35.

Skarin, H., Lindberg, A., Blomqvist, G., Aspán, A., Båverud, V. 2010. Molecular

characterization and comparison of Clostridium botulinum type C avian strains.

Avian Pathology 39, 511-518.

Smith, G.R., Moryson, C.J. 1977. The low prevalence of Clostridium botulinum in the

lakes, marshes and waterways of the Camargue. The Journal of Hygiene 78, 33-

37.

Smith, G.R., Turner, A. 1987. Factors affecting the toxicity of rotting carcasses

containing Clostridium botulinum type C. Epidemiology and Infection 98, 345–

351.

Song, K., Wang, Z., Du, J., Liu, L., Zeng, L., Ren, C. 2014. Wetland degradation: its

driving forces and environmental impacts in the Sanjiang Plain, China.

Environmental Management 54, 255-271.

Sonne, C., Olsen Alstrup, A.K., Therkildsen, O.R. 2012. A review of the factors causing

paralysis in wild birds: Implications for the paralytic syndrome observed in the

Baltic Sea. Science of the Total Environment 416, 32–39.

Soos, C., Wobeser, G. 2006. Identification of primary substrate in the initiation of avian

botulism outbreaks. Journal of Wildlife Management 70, 43-53.

Swerczek, T.W. 1980. Experimentally induced toxicoinfectious botulism in horses and

foals. American Journal of Veterinary Research 41, 348-350.


40

Takeda, M., Tsukamoto, K., Kohda, T., Matsui, M., Mukamoto, M., Kozaki, S. 2005.

Characterization of the neurotoxin produced by isolates associated with avian

botulism. Avian Diseases 49, 376-381.

Tebbe, C.C., Vahjen, W. 1993. Interference of humic acids and DNA extracted directly

from soil in detection and transformation of recombinant DNA from bacteria and

a yeast. Applied and Environmental Microbiology 59, 2657–2665.

Thomas, R.J. 1991. Detection of Clostridium botulinum types C and D toxin by ELISA.

Australian Veterinary Journal 68, 111-113.

Trampel, D.W., Smith, S.R., Rocke, T.E. 2005. Toxicoinfectious botulism in

commercial caponized chickens. Avian Diseases 49, 301-303.

Vidal, D., Taggart, M.A., Badiola, I., Mateo, R. 2011. Real-time polymerase chain

reaction for the detection of toxigenic Clostridium botulinum type C1 in

waterbird and sediment samples: comparison with other PCR techniques.

Journal of Veterinary Diagnostic Investigation 23, 942–946.

Werner, B.A., Johnson, W.C., Guntenspergen, G.R. 2013. Evidence for 20th century

climate warming and wetland drying in the North American Prairie Pothole

Region. Ecology and Evolution 3, 3471–3482.

Williamson, J.L., Rocke, T.E., Aiken, J.M. 1999. In situ detection of the Clostridium

botulinum Type C1 toxin gene in wetland sediments with a nested PCR assay.

Applied and Environmental Microbiology 65, 3240–3243.

Wobeser, G. 1997. Avian botulism – another perspective. Journal of Wildlife Diseases

33, 181–186.

Wolffs, P., Norling, B., Rådström, P. 2005. Risk assessment of false positive in

quantitative real-time PCR results in food, due to detection of DNA originating

from dead cells. Journal of Microbiological Methods 60, 315–323.


41

Work, T.M., Klavitter, J.L., Reynolds, M.H., Blehert, D. 2010. Avian botulism: a case

study in translocated endangered Laysan ducks (Anas laysanensis) on Midway

Atoll. Journal of Wildlife Diseases 46, 499–506.

Woudstra, C., Skarin, H., Anniballi, F., Fenicia, L., Bano, L., Drigo, I., Koene, M.,

Bäyon-Auboyer, M.H., Buffereau, J.P., De Medici, D., Fach, P. 2012.

Neurotoxin gene profiling of Clostridium botulinum types C and D native to

different countries within Europe. Applied and Environmental Microbiology 78,

3120-3127.

Woudstra, C., Aberg, A.T., Skarin, H., Anniballi, F., De Medici, D., Bano, L., Koene,

M., Löfström, C., Hansen, T., Hedeland, M., Fach, P. 2013. Animal botulism

outcome in the AniBioThreat project. Biosecurity and Bioterrorism: Biodefense

Strategy, Practice, and Science 11, 177-182.

Yule, A.M., Barker, I.K., Austin, J.W., Moccia, R.D. 2006. Toxicity of Clostridium

botulinum Type E neurotoxin to Great Lakes fish: implications for avian

botulism. Journal of Wildlife Diseases 42, 479–493.

Zechmeister, T.C., Kirschner, A.K., Fuchsberger, M., Gruber, S.G., Suess, B.,

Rosengarten, R., Pittner, F., Mach, R.L., Herzig, A., Farnleitner, A.H. 2005.

Prevalence of botulinum neurotoxin C1 and its corresponding gene in

environmental samples from low and high-risk avian botulism areas. ALTEX

22, 185–195.


42

ORGANIZACIÓN DE LA TESIS Y OBJETIVOS

Esta tesis se ha realizado en el marco de dos proyectos otorgados por el Organismo

Autónomo de Parques Nacionales del Ministerio de Agricultura, Alimentación y Medio

Ambiente, a través del programa de ayudas a la investigación en materias relacionadas con

la Red de Parques Nacionales en 2003 y 2009.

El primer proyecto se tituló “Análisis del riesgo de intoxicación por botulismo en

Malvasía cabeciblanca y otras especies de aves acuáticas en las Tablas de Daimiel y

humedales cercanos” (referencia OAPN 99/2003) y el segundo proyecto, continuación y

complemento del primero, se tituló “Estudio de los riesgos sanitarios para las aves acuáticas

asociados con el abastecimiento de las Tablas de Daimiel y otros humedales manchegos

con agua residuales urbanas tratadas” (referencia OAPN 35/2009).

Durante el primer proyecto se desarrolló una PCR a tiempo real para detectar C.

botulinum tipo C que permitiera analizar un gran número de muestras para estudios

epidemiológicos y se validó un método para usar esta PCR con muestras ambientales.

Posteriormente, el Capítulo 1 está orientado a aislar y caracterizar cepas de C. botulinum

productoras de brotes de botulismo aviar en humedales manchegos para determinar qué tipo

los causa. En el Capítulo 2 comienza el estudio de la ecología de C. botulinum tipo C/D y

se busca obtener una visión global sobre la frecuencia y causas del botulismo aviar en Las

Tablas de Daimiel y humedades colindantes. Los principales resultados de este estudio dan

pie al segundo proyecto y siguientes capítulos. En primer lugar, los brotes parecían ser más

frecuentes en humedales abastecidos con aguas residuales por lo que en el Capítulo 3 los

objetivos fueron identificar asociaciones entre los cambios que producen los vertidos de

Organización de la tesis y objetivos

43

aguas residuales en humedales y la aparición de brotes de botulismo, y estimar el grado de

exposición de las aves acuáticas a patógenos bacterianos procedentes de aguas residuales,

sobre todo con vistas a abastecer Las Tablas de Daimiel en caso de sequía. En segundo

lugar, tanto en el Capítulo 2 como en el 3 se detectan moscas calíforas (de hábitos

necrófagos) capturadas durante brotes de botulismo positivas a C. botulinum, lo que indica

que pueden tener un papel en la epidemiología de los brotes, por lo que en el Capítulo 4 se

estudia el posible papel de las moscas adultas en la propagación de los brotes. Por último,

dado el gran número de especies que se ven afectadas en la región por botulismo (datos

recogidos en el Capítulo 2), en el Capitulo 5 el objetivo es estimar la susceptibilidad al

botulismo de las principales especies de aves acuáticas que habitan en humedales

manchegos, con especial atención al efecto de la enfermedad sobre la malvasía

cabeciblanca y también valorar el papel de las aves como portadoras y dispersoras de C.

botulinum tipo C/D.

Así con esta serie de estudios pretendemos aportar nueva información sobre las

causas y consecuencias de esta enfermedad tan frecuente en la región e intentar aportar

soluciones, o al menos medidas preventivas, para que no se produzcan de nuevo episodios

como la gran mortalidad ocurrida en Las Tablas de Daimiel en 1999.

44

CAPÍTULO 1

Cepas de Clostridium botulinum de la misma rama causan el

botulismo aviar en el sur y en el norte de Europa

Cultivo puro de C. botulinum tipo C/D. Fotografía de Hanna Skarin.

Anza, I., Skarin, H., Vidal, D., Lindberg, A., Båverud, V., Mateo, R. 2014. The same clade

of Clostridium botulinum strains is causing avian botulism in southern and northern

Europe. Anaerobe 26, 20-23.

Capítulo 1

45

Cepas de Clostridium botulinum de la misma rama causan el botulismo aviar en el sur

y en el norte de Europa

RESUMEN

El botulismo aviar es una enfermedad paralizante causada por las neurotoxinas (BoNTs)

producidas por Clostridium botulinum, normalmente por el tipo C/D. Es una enfermedad

seria tanto para aves acuáticas como para pollos de granja en Europa. El objetivo de este

estudio fue comparar la genética de cepas aviares de C. botulinum aisladas en España con

cepas aisladas en Suecia usando la técnica de electroforesis en gel de campo pulsado

(EGCP). Se aislaron quince cepas de muestras aviares procedentes de España usando una

técnica de separación inmunomagnética. Las cepas aisladas fueron caracterizadas por PCR ,

y todas fueron identificadas como la genoespecie Clostridium novyi sensu lato y ocho

albergaban el gen que codifica la neurotoxina tipo C/D. El análisis con EGPC reveló cuatro

pulsotipos muy similares, de los cuales dos contenían cepas de ambos países. También

demostró que los brotes en aves salvajes y domésticas pueden ser causados por las mismas

cepas. Estos resultados apoyan la hipótesis de una expansión clonal del mosaico C/D por

Europa y da información importante para futuros estudios epidemiológicos basado en esta

técnica.


46

The same clade of Clostridium botulinum strains is causing avian botulism in southern

and northern Europe

ABSTRACT

Avian botulism is a paralytic disease caused by Clostridium botulinum-produced botulinum

neurotoxins (BoNTs), most commonly of type C/D. It is a serious disease of waterbirds and

poultry flocks in many countries in Europe. The objective of this study was to compare the

genetic relatedness of avian C. botulinum strains isolated in Spain with strains isolated in

Sweden using pulsed-field gel electrophoresis (PFGE). Fifteen strains were isolated from

Spanish waterbirds using an immunomagnetic separation technique. Isolates were

characterized by PCR, and all were identified as the genospecies Clostridium novyi sensu

lato and eight harbored the gene coding for the BoNT type C/D. PFGE analysis of the

strains revealed four highly similar pulsotypes, out of which two contained strains from

both countries. It also showed that outbreaks in wild and domestic birds can be caused by

the same strains. These results support a clonal spreading of the mosaic C. botulinum type

C/D through Europe and give relevant information for future epidemiological studies.

Capítulo 1

47

1. Introduction

Clostridium botulinum is an anaerobic spore-forming bacterium capable of

producing botulinum neurotoxins (BoNTs), responsible for botulism. The species can be

divided into four physiological and phylogenetical groups (I to IV), with seven different

serotypes of BoNTs, type A to G. The four groups correspond to different species at a

genetic level, but are considered the same species because of their capability for producing

BoNTs. Strains belonging to C. botulinum group III produce BoNTs of types C and D,

which are associated with botulism in animals (Collins and East, 1998; Hill et al., 2007).

Genetic recombination events between these two serotypes have resulted in mosaic forms

that comprise parts from both BoNT/C and BoNT/D genes; these are referred to as type

C/D or D/C. It has been shown that chimeric type C/D is more lethal to avian species than

either type C or D (Moriishi et al., 1996; Takeda et al., 2005). In Europe, Woudstra et al.

(2012) detected the mosaic forms in samples collected from cases of animal botulism from

France, Italy and the Netherlands but did not find types C or D. They proposed a clonal

spreading of the chimeric types in Europe, although subtyping data has so far not been

available to confirm this.

In central Spain, avian botulism outbreaks in wetlands occur almost every year and

kill thousands of waterbirds, including endangered species as the white-headed duck

(Oxyura leucocephala). Vidal et al. (2013) reported 13 outbreaks in wetlands between 1978

and 2008 where the mosaic type C/D form was confirmed with a conventional PCR method

in samples from waterbirds found dead during the outbreaks. On the southeast coast of

Sweden there were high levels of mortalities of seabirds, mainly herring gull (Larus


48

argentatus), between 2000 and 2004. All birds examined were confirmed to have died from

botulism (Neimanis et al., 2007). Large outbreaks of botulism in poultry flocks in Sweden

have also been described (Lindberg et al., 2010; Skarin et al., 2010). In a study by Skarin et

al. (2010), strains of C. botulinum isolated from herring gulls and broilers collected during

botulism outbreaks in Sweden and Norway were subtyped by pulsed-field gel

electrophoresis (PFGE). All the isolates contained the mosaic type C/D BoNT gene and

composed few pulsotypes. They proposed a common source of contamination could have

existed between the Scandinavian outbreaks, but as the genetic diversity of C. botulinum

group III is poorly known, it could not be confirmed. Our objective was to study the genetic

diversity of C. botulinum avian strains by investigating the genetic relatedness between

strains from Spain and Scandinavia.

2. Material and methods

2.1 Production of polyclonal antibodies towards spores of C. botulinum type C and C/D

strains

Antibodies were produced in order to facilitate isolation of strains from naturally

contaminated samples. Spores from six type C and C/D strains were produced as previously

described by Lindberg et al. (2010), with the addition of four intervals of five minutes

sonication and one hour incubation at 37 °C. The spores were washed in PBS supplemented

with 0.1% Tween 20 (PBST), centrifuged at 6000 x g for 5 min, and resuspended in 1 ml

1% formaldehyde solution with 0.1% Tween 20 and incubated for three days at 37 °C.

Spore concentration was determined by counting in a Bürker chamber. A concentration of

Capítulo 1

49

106 spores/ml was used for injection into rabbits using the standard protocol as described

by the producer (Innovagen). Antibodies from the second serum sample (taken day 63)

were IgG purified by the manufacturer (Innovagen). Antibodies (5 mg/ml) were

biotinylated using a EZ-Link NHS-PEG4-Biotin biotinylation kit (Thermo Fisher

Scientific).

2.2 Isolation of strains by immunomagnetic separation

Samples from 41 waterbirds collected from four different botulism outbreaks

occurring between 2010 and 2011 in three wetlands in south-central Spain were used for

isolation (Fig. 1).

Fig.1. Map of Spain showing the locations of the three wetlands (star) where the strains were

isolated from.

The samples included 38 livers, 6 caeca and 2 maggot pools. Pre-enrichment of the samples

was performed as previously described by Skarin et al. (2010). Briefly, 1 g of each sample


50

was inoculated into 9 ml pre-reduced tryptose-peptone-glucose-yeast extract (TPGY) broth

supplemented with 0.1% l-cysteine-HCl and 0.14% NaHCO3, heated for 15 min at 70 ºC

and incubated anaerobically at 37 ºC for two days. A volume of 10 µl of the overnight

cultures was washed in PBST (centrifugation at 6000 x g for 5 min) and resuspended in

PBST with 1% bovine serum albumin (PBSTB) and 50 µg biotinylated polyclonal

antibodies developed towards spores of type C and C/D strain, see above. The samples

were incubated at 25°C for 30 min and then centrifuged 10 min 10 000 x g to remove

unspecific antibodies. The pellets were resuspended in phosphate-citrate buffer (pH 4) with

0.1% Tween-20, mixed with 10 µl streptavidin-coated Dynabeads T1 (Invitrogen Life

technologies) and incubated at 25 °C for 30 min. A magnetic rack was used to wash the

magnetic beads, which were washed 1 time with phosphate-citrate buffer pH 4 with 0.1%

Tween-20, twice with PBSTB and finally dissolved in 100 µl PBST. The bead suspensions

were heated to 70 °C for 10 minutes (to kill vegetative cells) and streaked on McClung

Toabe agar (supplemented with 0.1% l-cysteine-HCl and 0.14% NaHCO3). Agar plates

were incubated anaerobically at 37 ºC for 2 days. Colonies positive for lipase and

lecithinase were cultured overnight at 37 ºC in 9 ml TPGY broth. Cells were harvested by

centrifugation at 3000 x g for 15 min prior to DNA extraction (as described below).

2.3 DNA extraction and identification of strains by PCR

DNA was automatically extracted in the BioRobot® EZ1 workstation (Qiagen) with

an elution volume of 50 μl. The identity of the isolates was confirmed using a real-time

PCR, which amplifies a sequence of a chromosomal gene (coding for 50S ribosomal

protein L10) using primers F_50SRP (GGAACCAACCTACCGAGGAT) and R_50SRP

Capítulo 1

51

(CCGTAGCCACCTCCTTAACA). The software Gegenees (Agren et al., 2012) was used

to define the chromosomal target, which was conserved among strains belonging to C.

novyi sensu lato (C. botulinum group III, C. novyi and C. haemolyticum) (Skarin et al.,

2010). Primers were designed using the Primer3 software (Rozen and Skaletsky, 2000).

The real-time PCR mixture (25 l) consisted of 12.5 l PerfeCTa SYBR® Green SuperMix

Low ROX (Quanta BioSciences), 10 M of each primer and approximately 10 ng of

template. The real-time PCR conditions consisted of initial denaturation and Taq

polymerase activation at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and

60 °C for 60 s, followed by a melting curve analysis. The same master mix and PCR

program were applied in the BoNT characterization PCR assays described next. The

presence of the gene coding for the BoNT type C light chain was investigated using the

primers described by Lindberg et al. (2010). Positive samples were further analysed by

primers (D-III_F and D-III_R) targeting the C-terminal part of the heavy chain of type D,

thus confirming the mosaic type C/D (Woudstra et al., 2012). All PCR reactions were

performed in a 7500 real-time PCR system (Applied Biosystems).

2.4 Subtyping of the strains by PFGE analysis

The PFGE analysis was performed following the protocol optimized by Skarin et al.

(2010) using restriction enzyme SmaI (New England BioLabs). Two Swedish avian type

C/D strains (V891 and BKT015925), isolated from herring gull and slaughter chicken in

2007 and 2008, respectively, along with a type C strain (C-Stockholm) isolated from mink

were included in the PFGE comparison. From previous analysis by Skarin et al. (2010), the

two Swedish avian strains represented two different pulsotypes of high similarity, where


52

one included only strains from wild birds from Sweden and the other included strains from

chicken from Sweden and Norway. Comparisons of PFGE patterns and cluster analysis

were performed with the BioNumeric 6.5 software (Applied Maths). The level of similarity

between the DNA patterns was estimated using the Dice coefficient correlations and the

clusters were done with the unweighed pair group method using arithmetic averages. The

position tolerance was set at 2% and the optimization value at 1%.

3. Results

In total, 15 strains were isolated by immunomagnetic separation from 14 waterbirds

of different species from three wetlands in Spain (Fig. 2). All the isolates were positive for

the C. novyi sensu lato chromosomal gene and eight carried the type C/D BoNT gene. All

strains were analyzed by PFGE and 11 of them generated bands with a sufficient quality for

computer analysis. The comparison of the SmaI restriction profiles of the Spanish strains

with the Swedish avian strains revealed a very high level of similarity. All avian strains

could be grouped into four different pulsotypes, which shared more than 93% similarity

(Fig. 2). The first pulsotype consisted of two strains originating from two different wetlands

in Spain. The second pulsotype consisted of five Spanish strains from two different

wetlands, and the Swedish strain from chicken (BKT015925). The third pulsotype

consisted of three Spanish strains from two different wetlands, and the Swedish strain

isolated from a gull (V891). The fourth pulsotype consisted of only one Spanish strain. The

type C strain (C-Stockholm) formed a more distant branch (58.8% similarity) to the avian

Capítulo 1

53

strains. The four isolated strains that generated banding patterns of lower quality did not

correspond to additional pulsotypes.

Fig.2. Dendrogram of C. botulinum type C/D isolates from wild birds from Spain, one Swedish C.

botulinum type C/D isolate from chicken (BKT015925) and one from herring gull (V891), and the

C. botulinum type C strain C-Stockholm (C-St) isolated from mink.

4. Discussion

The immunomagnetic separation technique was found to be valuable for isolation of

C. botulinum group III strains, something which have previously been described to be

challenging (Skarin et al., 2010; Woudstra et al., 2012). C. botulinum isolates from birds in

Europe and Japan seem to be predominantly of type C/D (Takeda et al., 2005; Skarin et al.,

2010; Vidal et al., 2013). In fact, in some European countries, the mosaic forms (C/D and

D/C) are the most common types overall in samples from animal botulism outbreaks

(Woudstra et al., 2012). This is supported in this study, with strains isolated from Spanish

avian samples characterized by real-time PCR into type C/D. The Spanish strains isolated


54

in this study were found to be genetically very similar to strains isolated from both wild

birds and chicken in Scandinavia and it was not possible to discriminate between strains

based on origin of isolation. This also shows that outbreaks in wild and domestic birds can

be caused by the same strains. Woudstra et al. (2012) suggested a clonal spread of the

mosaic types through Europe. Our results support this hypothesis as we found the same

strains in two distant parts of Europe with different climate and aquatic ecosystems. It was

shown by Skarin et al. (2010) that the two Swedish strains used in this study, which

generated two pulsotypes of >93% similarity, were genomically highly similar. The major

difference between the strains was the content of plasmids. However, neither of the two

unique plasmids (one in each strain) contains a SmaI site, so the explanation for the

difference in PFGE patterns is more likely attributed to the difference in locations of mobile

elements, which are scattered in both genomes (Skarin et al., 2011). It is unlikely that the

restricted diversity in strains is limited to the most southern and northern parts of Europe. It

is more likely that there is one clade, representing closely related strains, responsible for the

majority of avian botulism outbreaks across Europe and to be blamed for the death of

thousands of wild and domesticated birds. It is possible that C. botulinum is exposed to

strong selection that favors the survival of a particular genotype in a specific niche. Genetic

analysis of more C. botulinum group III strains is needed to clarify if the diversity can be

correlated to niche, such as the animal species. Migratory waterbirds (Anatidae and

shorebirds) are considered vehicles for spread throughout Europe acting as passive vectors

for aquatic organisms (Green et al., 2002). The waterbird species used in this study for

isolation of C. botulinum, except for the white-headed duck and the black-winged stilt

Capítulo 1

55

(Himantopus himantopus), all migrate between Scandinavian countries and Spain

(SEO/Birdlife, 2012).

5. Conclusions

Comparisons between the C. botulinum type C/D strains isolated from wild birds in

Spain and type C/D strains isolated from wild and domesticated birds in Scandinavia

revealed a very high level of genetic similarity. It is likely that there is one clade of closely

related strains mainly responsible for causing avian botulism in Europe. Our data show that

conclusions about the geographical origin of a strain cannot be drawn from comparisons

based on genetic relatedness alone.

Acknowledgements

This research was supported by/executed in the framework of the EU-project

AniBioThreat (Grant Agreement: Home/2009/ISEC/AG/191) with the financial support

from the Prevention of and Fight against Crime Programme of the European Union,

European Commission – Directorate General Home Affairs. This publication reflects the

views only of the author, and the European Commission cannot be held responsible for any

use which may be made of the information contained therein. The project was also

sponsored by the Spanish Ministry of Environment (Grant OAPN 035/2009). IA was

supported by a JAE PRE grant from the Spanish Council of Research (CSIC). The IMS

methodology was financed by the Norwegian Agricultural Authority, Animalia,

Felleskjøpet fôrutvikling, Fiskå Mølle and Norgesfôr through the Norwegian Research


56

Council (Grant Number 199375/I99). We gratefully acknowledge the efforts of the field

personnel who submitted carcasses and the staff of the wildlife rehabilitation centers.

References

Agren, J., Sundström, A., Håfström, T., Segerman, B. 2012. Gegenees: fragmented

alignment of multiple genomes for determining phylogenomic distances and genetic

signatures unique for specified target groups, Plos One 7, e39107.

Collins, M.D., East, A.K. 1998. Phylogeny and taxonomy of the food-borne pathogen

Clostridium botulinum and its neurotoxins. Journal of Applied Microbiology 84, 5–

17.

Green, A.J., Figuerola, J., Sánchez, M.I. 2002. Implications of waterbird ecology for the

dispersal of aquatic organisms. Acta Oecologica 23, 177–189.

Hill, K.K., Smith, T.J., Helma, C.H., Ticknor, L.O., Foley, B.T., Svensson, R.T., Brown,

J.L., Johnson, E.A., Smith, L.A., Okinaka, R.T., Jackson, P.J. Marks, J.D. 2007.

Genetic diversity among botulinum neurotoxin-producing clostridial strains. Journal

of Bacteriology 189, 818-832.

Lindberg, A., Skarin, H., Knutsson, R., Blomqvist, G., Båverud, V. 2010. Real-time PCR

for Clostridium botulinum type C neurotoxin (BoNTC) gene, also covering a

chimeric C/D sequence-application on outbreaks of botulism in poultry. Veterinary

Microbiology 146, 118-123.

http://www.ncbi.nlm.nih.gov/pubmed?term=Hill%20KK%5BAuthor%5D&cauthor=true&cauthor_uid=17114256

http://www.ncbi.nlm.nih.gov/pubmed?term=Lindberg%20A%5BAuthor%5D&cauthor=true&cauthor_uid=20537470

http://www.ncbi.nlm.nih.gov/pubmed?term=Knutsson%20R%5BAuthor%5D&cauthor=true&cauthor_uid=20537470

http://www.ncbi.nlm.nih.gov/pubmed?term=Blomqvist%20G%5BAuthor%5D&cauthor=true&cauthor_uid=20537470

http://www.ncbi.nlm.nih.gov/pubmed?term=B%C3%A5verud%20V%5BAuthor%5D&cauthor=true&cauthor_uid=20537470

http://www.ncbi.nlm.nih.gov/pubmed/20537470


Capítulo 1

57

Moriishi, K., Koura, M., Abe, N., Fujii, N., Fujinaga, Y., Inoue, K., Oguma, K. 1996.

Mosaic structure of neurotoxins produced from Clostridium botulinum types C and

D organisms. Biochimica et Biophysica Acta 1307, 123-126.

Neimanis, A., Gavier-Widén, D., Leighton, F., Bollinger, T., Rocke, T., Mörner, T. 2007.

An outbreak of type C botulism in herring gulls (Larus argentatus) in southeastern

Sweden. Journal of Wildlife Diseases 43, 327-736.

Rozen, S., Skaletsky, H. 2000. Primer3 on the WWW for general users and for biologist

programmers. Methods in Molecular Biology 132, 365-386.

SEO/BirdLife. 2012. Análisis preliminar del banco de datos de anillamiento de aves del

Ministerio de Agricultura, Alimentación y Medio Ambiente, para la realización de

un atlas de migración de aves de España. SEO/BirdLife-Fundación Biodiversidad,

Madrid. http://www.seo.org/resultados-seguimiento-de-aves/?PRO=PM&ESP=750.

Skarin, H., Håfström, T., Westerberg, J., Segerman, B. 2011. Clostridium botulinum group

III: a group with dual identity shaped by plasmids, phages and mobile elements.

BMC Genomics 12, 185.


characterization and comparison of Clostridium botulinum type C avian strains,





Vidal, D., Anza, I., Taggart, M.A., Pérez-Ramírez, E., Crespo, E., Hofle, U., Mateo, R.

2013. Environmental factors influencing the prevalence of Clostridium botulinum

http://www.ncbi.nlm.nih.gov/pubmed?term=Neimanis%20A%5BAuthor%5D&cauthor=true&cauthor_uid=17699071

http://www.ncbi.nlm.nih.gov/pubmed?term=Gavier-Wid%C3%A9n%20D%5BAuthor%5D&cauthor=true&cauthor_uid=17699071

http://www.ncbi.nlm.nih.gov/pubmed?term=Gavier-Wid%C3%A9n%20D%5BAuthor%5D&cauthor=true&cauthor_uid=17699071

http://www.ncbi.nlm.nih.gov/pubmed?term=Bollinger%20T%5BAuthor%5D&cauthor=true&cauthor_uid=17699071

http://www.ncbi.nlm.nih.gov/pubmed?term=Bollinger%20T%5BAuthor%5D&cauthor=true&cauthor_uid=17699071

http://www.ncbi.nlm.nih.gov/pubmed?term=M%C3%B6rner%20T%5BAuthor%5D&cauthor=true&cauthor_uid=17699071


http://www.ncbi.nlm.nih.gov/pubmed?term=Skarin%20H%5BAuthor%5D&cauthor=true&cauthor_uid=21154062


http://www.ncbi.nlm.nih.gov/pubmed?term=Blomqvist%20G%5BAuthor%5D&cauthor=true&cauthor_uid=21154062

http://www.ncbi.nlm.nih.gov/pubmed?term=Asp%C3%A1n%20A%5BAuthor%5D&cauthor=true&cauthor_uid=21154062




58

type C in non-permanent Mediterranean wetlands. Applied and Environmental


Woudstra, C., Skarin, H., Anniballi, F., Fenicia, L., Bano, L., Drigo, I., Koene, M., Bäyon-

Auboyer, M.H., Buffereau, J.P., De Medici, D., Fach, P. 2012. Neurotoxin gene

profiling of Clostridium botulinum types C and D native to different countries

within Europe. Applied and Environmental Microbiology 78, 3120-3127.

59

CAPÍTULO 2

Factores ambientales que influyen en la prevalencia de

Clostridium botulinum tipo C/D en humedales mediterráneos

no permanentes

Muestreo en las Navas de Malagón, Ciudad Real. Fotografía de Ibone Anza

Vidal, D., Anza, I., Taggart,

M.A., Pérez-Ramírez,

E., Crespo, E., Hofle,

U.,

Mateo, R.

2013. Environmental factors influencing the prevalence of Clostridium botulinum type

C/D in non-permanent Mediterranean wetlands. Applied and Environmental



60

Factores ambientales que influyen en la prevalencia de Clostridium botulinum tipo

C/D en humedales mediterráneos no permanentes

RESUMEN

Entre 1978 y 2008, se han registrado 13 brotes de botulismo aviar en humedales de La

Mancha Húmeda (Castilla-La Mancha). Estos brotes causararon la muerte de alrededor

de 20.000 aves de más de 50 especies, incluyendo especies globalmente amenazadas

como la malvasía cabeciblanca (Oxyura leucocephala). En este estudio encontramos

una asociación significativa entre el número de de aves muertas en cada brote y la

temperatura media de Julio (siempre > 26 ºC). El clostridio fue detectado mediante PCR

a tiempo real en el 5,8% de las 207 muestras de sedimento recogidas entre 2005 y 2008

en humedales manchegos. Su presencia en sedimentos fue significativamente asociada

con bajas concentraciones de Cl-

y altas de materia orgánica. Se analizaron 75 tractos

digestivos de aves encontradas muertas durante brotes de botulismo y C. botulinum fue

detectado en el 38,7% de ellos. La prevalencia de C. botulinum fue de 18,2% (n= 22

pools) en invertebrados acuáticos (quironómidos y corixidos) y 33,3% (n= 18 pools) en

invertebrados necrófagos (Sarcophagidae y Calliphoridae), incluyendo dos pools de

moscas necrófagas adultas capturadas cerca de cadáveres de aves. La presencia de la

bacteria en moscas adultas abre nuevas perspectivas en la epidemiología del botulismo

aviar dado que estas podrían transportar esporas de C. botulinum entre cadáveres.

Capítulo 2

61

Environmental factors influencing the prevalence of Clostridium botulinum type

C/D in non-permanent Mediterranean wetlands

ABSTRACT

Between 1978 and 2008, 13 avian botulism outbreaks were recorded in the wetlands of

La Mancha Húmeda (Central Spain). These outbreaks caused the deaths of around

20,000 birds from over 50 species, including globally endangered white-headed ducks

(Oxyura leucoceophala). Here, a significant association was found between the number

of dead birds recorded in each botulism outbreak and the mean temperature in July

(always >26ºC). The presence of C. botulinum type C/D in wetland sediments was

detected by real-time PCR (qPCR) in 5.8% of 207 samples collected between 2005 and

2008. Low concentrations of Cl- and high organic matter content in sediments were

significantly associated with the presence of C. botulinum. Seventy five digestive tracts

of birds found dead during botulism outbreaks were analysed; C. botulinum was present

in 38.7% of them. The prevalence of C. botulinum was 18.2% (n = 22 pools) in aquatic

invertebrates (Chironomidae and Corixidae) and 33.3% (n = 18 pools) in necrophagous

invertebrates (Sarcophagidae and Calliphoridae), including two pools of adult

necrophagous flies collected around bird carcasses. The presence of the bacteria in the

adult fly form opens up new perspectives in the epidemiology of avian botulism since

these flies may be transporting C. botulinum from one carcass to another.


62

1. Introduction

Botulism poisoning is caused by the ingestion of a potent neurotoxin (botulinum

neurotoxin [BoNT]) secreted by Clostridium botulinum that produces flaccid paralysis

and death. Seven toxin subtypes have been designated (from A to G), with type C most

frequently involved in cases of avian botulism (Mitchell and Rosendal, 1987; Rocke and

Friend, 1999), followed by types D and E. Avian botulism has been diagnosed around

the world (except in the Antarctic) and is considered the most important avian disease in

terms of mortality (Rocke, 2006). Recently, some cases of botulism in animals in

Europe and Japan were caused by mosaics of types C and D toxin, for which a higher

lethal activity is observed in mouse in comparison to other types of BoNT (Takeda et

al., 2005; Lindberg et al., 2010; Skarin et al., 2010). This mosaic C/D type toxin seems

to be predominant in European waterfowl and cross–reacts against type C antisera in the

commonly used mouse bioassay (Woudstra et al., 2012).

Clostridium botulinum type C is not considered overtly pathogenic, but acts as a

saprophytic bacterium that uses a neurotoxin (BoNT) to kill in order to create an

appropriate medium for its maintenance (Peck, 2009). The exponential mortality

observed during outbreaks of avian botulism has been associated with the life cycle of

necrophagous flies and their maggots. The maggots act as a carrier of BoNT from

decomposing bird carcasses to live birds (Duncan and Jensen, 1976; Shayegani et al.,

1984; Evelsizer et al., 2010a). In terms of botulism outbreaks, there are several

predisposing factors which have complex relationships (Rocke, 2006). One of these

factors is the abundance of C. botulinum spores in the environment, which may in turn

depend on local soil, sediment, and water properties (Marion et al., 1983; Wobeser et

al., 1987; Contreras de Vera et al., 1991; Sandler et al., 1993; Babinszky et al., 2008).

Capítulo 2

63

The high temperatures that are reached in summer in wetlands favour the growth of C.

botulinum in carcasses or in decomposing organic material (Borland et al., 1977;

Wobeser and Galmut, 1984; Woo et al., 2010). Bird mortality due to other causes can

contribute to botulism by providing carcasses where C. botulinum can grow and initiate

an outbreak (Soos and Wobeser, 2006; Evelsizer et al., 2010b). Finally, the

susceptibility of certain bird species or individuals to the BoNT toxin may be an

important determinant (Dohms and Cloud, 1982; Wobeser, 1988; Rocke, 2006).

Botulism can be a significant risk for endangered waterbird species, especially

for those with populations concentrated in just a few wetlands or on islands, where an

outbreak may reduce their numbers dramatically (Work et al., 2010). White-headed

duck (Oxyura leucocephala) and marbled teal (Marmaronetta angustirrostris) are

endangered and vulnerable (IUCN, 2012) waterfowl species and southern Spain is one

of their population strongholds within the Western Palearctic (Torres-Esquivias, 2008).

Some of the wetlands used by these species as breeding sites in Spain, such as El Hondo

on the Mediterranean coast, La Mancha Húmeda in central Spain and the Guadalquivir

Marshes in southern Spain, can be considered areas where avian botulism is endemic,

since outbreaks occur there almost every summer (Villalba et al., 1989, León-Quinto et

al., 2004; Vidal et al., 2011). Botulism may therefore continue to drive these already

vulnerable species toward a more critical status and reduce the efficacy of important

conservation efforts made over recent decades (Torres-Esquivias, 2004).

Here, we compiled available data on botulism outbreaks in the wetlands of La

Mancha Húmeda for the last 20 years and explored their association with

meteorological data. The presence of C. botulinum type C in wetland sediments was

assessed using real-time PCR (quantitative PCR [qPCR]) and the relationship between

its occurrence and the physicochemical characteristics of the sediments analysed.


64

Moreover, the presence of C. botulinum in aquatic invertebrates and necrophagous flies

sampled during botulism outbreaks was studied to evaluate their role in the

epidemiology of these episodes.


2.1 Study area.

The study area consisted of wetlands in Castilla-La Mancha (central Spain), and

the study focused on the National Park of Tablas de Daimiel and nearby wetlands where

botulism outbreaks have been recorded since 1978 (Fig. 1). Tablas de Daimiel was

declared National Park in 1973, Special Protection Area for Birds in 1988 and was

included in the Ramsar List in 1982. The National Park now protects the remaining

1,675 ha of a wetland that 50 years ago comprised 6,000 ha (Álvarez-Cobelas and

Cirujano, 1996). Four of the wetlands studied also receive inputs from wastewater

treatment plants from nearby towns/villages (Fig. 1). We included two reservoirs

because birds from the natural wetlands often use these sites for feeding or resting since

there are large areas of shallow water with abundant vegetation present (Fig. 1).

The climate in this area is cold-temperate continental, with a pronounced dry

season and annual rainfall of around 400-500 mm. All the lagoons studied are between

603 and 670 m above sea level (Álvarez-Cobelas and Cirujano, 1996).

Manjavacas, Alcázar de San Juan and Pedro Muñoz lagoons are characterized

by a salt concentration >5 g/l even at the height of flooding, and they have historically

shown marked seasonality in terms of water level (since water supplies to these lagoons

were originally limited only to rainfall and runoff).

Capítulo 2

65

Fig. 1. Locations of the studied wetlands in Castilla-La Mancha. Most sites were located in the

province of Ciudad Real; only Manjavacas was located in Cuenca. The surface areas (in

hectares) are shown in parentheses on the map. Inh, inhabitants.

However, water discharged from wastewater treatment plants into these lagoons

has altered their more natural hydrological character (Cirujano and Medina, 2002).

Navaseca lagoon is a highly eutrophic artificial wetland which is close to Tablas de

Daimiel Park (6.5 km away).

2.2 Historic data and sample collection.

Waterfowl mortalities due to botulism outbreaks were compiled from official

data recorded between 1978 and 2008 by the regional government (Junta de

Comunidades de Castilla-La Mancha [JCCM]). The diagnosis of avian botulism was

based on clinical observations made by veterinary staff at the Wildlife Rehabilitation

Centres of JCCM and confirmed by mouse bioassay with a hexavalent antitoxin


66

provided by the Center for Disease Control and Prevention, Atlanta, GA, USA, and

undertaken at the Spanish National Institute of Toxicology. The mouse bioassay was

performed using sera from eight birds from five different outbreaks that occurred in

Mancha Húmeda between 1998 and 2002.

Monthly meteorological data (minimum, maximum and mean temperatures,

number of days >25 ºC, mean rainfall and mean humidity) for the study area between

1997 and 2008 were obtained from the Spanish National Institute of Statistics

(http://www.ine.es).

A total of 207 sediment samples were collected between 2005 and 2008 in the

studied wetlands. In July 2005, sediment samples were collected in Tablas de Daimiel

(n = 14), Alcázar de San Juan (n = 24), Pedro Muñoz (n = 15), Manjavacas (n = 9),

Vicario (n = 8) and Vega del Jabalón (n = 2). In January 2006, sediment samples were

collected in Tablas de Daimiel (n = 11), Vega del Jabalón (n = 9) and Vicario (n = 10).

Additionally, between 2006 and 2008, sediment samples were collected in

wetlands where avian mortalities had been detected during the summer, i.e., in Tablas

de Daimiel in 2007 (n = 68), Alcázar de San Juan in 2006 to 2008 (n = 13), Navaseca in

2008 (n = 14) and Jabalón in 2008 (n = 2). Sediment samples (50 to100 g) were

collected from the upper 0-5 cm. Benthic invertebrates, mostly larvae of chironomids

(non-biting midges), and water column invertebrates, mostly corixids (water bugs),

were collected during sediment sampling and processed in pools grouped by sampling

site.

Carcasses of 75 birds from 18 species were sampled during avian mortalities

detected in the wetlands studied. These samples included gastric contents, intestines,

cecum and cloacal swabs, although not all could be taken from each bird. Additionally,

5 pools of adult necrophagous flies, mostly Calliphoridae and Sarcophagidae families,

http://www.ine.es/

Capítulo 2

67

were caught flying around bird carcasses, as were 10 pools of maggots, 3 of eggs and 1

of pupae (of Calliphoridae), collected directly from bird carcasses. All samples were

frozen immediately at -30 ºC and stored until analysis.

2.3 Detection of C. botulinum: pre-enrichment cultures, qPCR and PCR for type C/D.

All samples were processed as previously described by Vidal et al. (2011).

Detection followed a protocol that included the preenrichment of the sample by culture,

DNA extraction, and the detection of the gene encoding for the toxin by qPCR.

Cultivation of samples was performed in a commercial cooked meat broth

supplemented with vitamin K1, glucose and hemine (BD BBL cooked meat medium

with glucose, hemin and vitamin K,; BD, NJ, USA) using an anaerobe container system

(BD GasPak EZ; BD, NJ, USA) over a period of 3-5 days at 40 ºC. DNA extraction was

performed using two commercial kits for DNA extraction: the PowerSoil DNA isolation

kit (MoBio, Carlsbad, CA, USA) and the DNAeasy blood and tissue kit (Qiagen,

Hilden, Germany), for sediments and animal tissue samples respectively (following the

manufacturer’s recommendations). qPCR was performed as described previously

(Sánchez-Hernández et al., 2008), including encoding genes of both type C and type

C/D mosaic toxins, and has been adapted for environmental samples by Vidal et al.

(2011). The amplicon of the qPCR is within the amino-terminal domain of the heavy

chain, and it specifically addresses position 2014 bp for the forward primer and 2112 bp

for the reverse primer using the BoNT sequence of the type C/D mosaic strain 03-009

(GenBank Accesion Number AB200360) (Takeda et al., 2005). In order to confirm

whether field samples were positive to type C/D mosaic, a total of 30 samples were also

tested with a standard PCR by the method of Takeda et al. (2005). The sensitivity of


68

this PCR was compared to the qPCR using an isolated strain from the gastric content of

a black-headed gull (Chroicoceplus ridibundus), collected in the summer of 2005 in an

outbreak that occurred in La Veguilla lagoon (internal reference IREC-B136) which

was quantified by the most probable number technique (MPN) technique.

2.4 Determination of the physicochemical characteristics of the sediments.

Each fresh sediment sample (10 g) was mixed with 30 ml of deionized water for

30 minutes on a shaker. The pH was measured in the solution after 2 minutes. The

solution was vacuum-filtered through a 0.45 µm filter paper. This filtrate was then used

to determine water-soluble PO4-, NO3

-, NO2

- and Cl

- by means of UV-Vis

spectrophotometry using SprectroquantTM

kits (Merck, Darmstadt, Germany). Moisture

and organic matter content were determined sequentially, first by drying the sample at

120 °C in an oven to calculate the amount of free and combined water present in the

sample, and then by heating in a muffle furnace at 450 °C to calculate the percentage

loss on ignition (% LOI).

2.5 Statistical analysis.

The relationship between avian mortality rate (due to botulism outbreaks) and

meteorological data was analysed with Spearmans’s correlation coefficient (rS). The

frequency of detection of C. botulinum in different types of samples was compared by

means of chi-square test or Fisher exact probability tests. Physicochemical

characteristics of sediments were compared among wetlands with one-way analysis of

variance (ANOVA) tests. Post-hoc differences were studied with Tukey tests. The

association between the presence of C. botulinum and the physicochemical

Capítulo 2

69

characteristics of the sediments was studied with generalized linear models (GLM) with

a binary logistic distribution. The presence of C. botulinum (negative or positive) was

used as the dependent variable and the physicochemical characteristics of the sediments

were used as the predictors. Physicochemical data were log-transformed when

necessary to approach a normal distribution. The studied models initially included all

the known predictors, but only those with higher significance were retained in the final

models following a backward stepwise procedure. Significance for the statistical

analyses was set at p≤0.05 and analyses were performed with IBM SPSS Statistics

19.0.0.

3. Results

3.1 Description of avian botulism outbreaks.

Between 1978 and 2008, 13 botulism outbreaks were recorded within the study

area. Around 20,000 individuals from more than 50 species from 18 families (Table 1

and Table S1 in the supplemental material) were found dead by environmental

authorities during these outbreaks. The most frequently affected family was Anatidae,

followed in smaller numbers by Rallidae and Scolopacidae (Table 1). In terms of

species, the highest mortality rates were reported for mallards (Anas platyrhynchos),

Eurasian coot (Fulica atra), gadwall (Anas strepera) and Northern shoveler (Anas

clypeata) (Table S1). Two threatened waterfowl species (IUCN, 2012), the endangered

white-headed duck and the near-threatened ferruginous duck (Aythya nyroca) were also

found dead in small numbers during these outbreaks. The presence of BoNT was

confirmed by mouse bioassay in seven birds (six mallards and one common teal [Anas


70

crecca]) collected in four different outbreaks prior to 2002. One negative sample was

from a black-headed gull which was sampled during recovery and finally released.

A significant association was found between the number of dead birds counted

during the botulism outbreaks and the mean temperature in July (rs = 0.745, p = 0.005).

Most of these outbreaks (9 out of 13) were initiated or occurred in July and all occurred

when the mean temperature during this month was above 26 ºC (Fig. 2). No other

correlations were found between botulism mortality and the rest of the meteorological

data.

Fig. 2. Relationship between avian mortalities (log transformed data) detected in botulism

outbreaks and the mean temperature during the month of July between 1997 and 2008 (rS =

0.745; P = 0.005). Shown is the regression (solid line) with 95% confidence interval (broken

lines).

71

Table 1. Official mortality rates of birds grouped by families due to avian botulism outbreaks in Castilla-la Mancha wetlands between 1978 and 2008.

Family N of species Year Total

1978 1998 1999 2002 2004 2005 2006 2008

Podicipedidae 4 83 2 10 0 1 0 3 0 99

Ardeidae 1 18 0 344 0 12 41 3 0 418

Ciconiidae 1 1 0 3 1 4 4 9 0 22

Phoenicopteridae 1 0 0 0 3 2 0 0 0 5

Anatidae 12 2.755 251 9.572 1 93 454 489 172 13.787

Accipitridae 2 4 0 0 0 0 0 2 0 6

Phasianidae 1 1 0 0 0 0 0 0 0 1

Rallidae 3 348 603 850 3 34 41 112 19 2.010

Recurvirostridae 2 513 191 38 11 15 6 29 2 805

Charadridae 4 577 0 7 6 1 1 2 1 595

Scolopaciae 12 1.081 0 21 0 4 0 0 10 1.116

Glareolidae 1 0 0 0 0 0 0 1 0 1

Laridae 3 316 343 117 16 4 0 65 2 863

Sternidae 6 64 0 18 1 0 1 60 0 144

Tytonidae 1 1 0 0 0 0 0 0 0 1

Laniidae 1 1 0 0 0 0 0 0 0 1

Passeriformes 1 0 0 0 0 0 0 4 0 4

Columbidae 1 0 0 0 0 0 0 1 0 1

Total 57 5.763 1.390 10.980 42 170 548 780 206 19.879


72

3.2 Identification of C. botulinum type.

The strain isolated from one black-headed gull was confirmed as the type C/D

mosaic with the conventional PCR and qPCR. The sensitivity of the qPCR with this

strain was around 2.5 spores/ml (1 to 6 spores, 95% confidence interval), whereas for

the conventional PCR it was about 250 spores/ml (Table 2 and Fig. 2). The presence of

the type C/D mosaic was also confirmed by conventional PCR in 16 of 22 field samples

that were previously positive to the qPCR.

Table 2. Sensitivity of the qPCR (Vidal et al., 2011) and conventional PCR (cPCR) (Takeda et

al., 2005) using serial ten-fold dilutions of a reference strain (IREC-B136), tested in triplicate.

Mean Spores/ml

(NMP)

Positive replicates

cPCR (type C/D mosaic)

Positive replicates

qPCR

Mean Ct qPCR

250000 3/3 3/3 28,43

25000 3/3 3/3 30,42

2500 1/3 3/3 32,45

250 1/3 3/3 34,89

25 0/3 3/3 37,56

2.5 0/3 3/3 39,56

0.25 0/3 0/3 0

0.025 0/3 0/3 0

0.0025 0/3 0/3 0

Capítulo 2

73

Fig. 2. A: Detection limit of cPCR for type C/D mosaic using primers CD/Fw and D/Rv from

Takeda et al. (2005); M=100 bp DNA ladder; lines 1-6 ten-fold dilutions of reference strain

(IREC-B136): from 25000 to 0.25 UFC/ml; lines 7 and 8 strain IREC-CB13 (from outbreak of

2010, not included in the paper), line 7 is 790 UFC/ml and line 8 is 79 UFC/ml (both positives

to qPCR). B: Samples positives by qPCR (lines 1-3, tissues; lines 4-6, invertebrates; lines 7-9,

cloacal swabs; line 10 strain IREC-B136; line 11: negative control).

3.3 C. botulinum in environmental samples and birds.

The overall prevalence of C. botulinum type C/D in preenriched sediment

samples was 5.8%. By wetland, Alcázar de San Juan wetland showed the highest

prevalence, followed by Vega del Jabalón and Tablas de Daimiel wetlands, with values

of 10.8%, 9.5% and 6.5% respectively (Table 4). Most of the positive sediments (10 out

of 12) were collected during botulism outbreaks which always started in June or July

(Table 3). Interestingly, none of the 14 sediments collected during the Navaseca

outbreak which started at the end of September 2008, were positive by qPCR (Table 3).


74

Table 3. Distribution of botulism positive sediments by year and by wetland (positive

sediments/total sediments sampled).

Wetland Year Month Botulism

outbreak

Positives/total

analyzed

Total positives

by wetland

Tablas of Daimiel Park 2005 Jul No 1/14 6/93

2006 Jan No 0/11

2007 Ag Yes 5/50

Sep Yes 0/18

Navaseca 2008 Sep Yes 0/14 0/14

Alcazar Lagoons 2005 Jul Yes 1/24 4/37

2006 Jul No 0/1

2007 Sep No 0/1

2008 Jul Yes 3/11

Manjavacas lagoons 2005 Jul No 0/9 0/9

Pedro Muñoz lagoons 2005 Jul No 0/15 0/15

Jabalon Reservoir 2005 Jul Yes 2/10 2/21

2006 Jan No 0/9

2008 Ag No 0/2

Vicario Reservoir 2005 Sep Yes 0/8 0/18

2006 Jan No 0/10

Total 12/207

All the physicochemical characteristics of the sediments were found to differ

among wetlands (Table 5), and the characteristics that were significantly associated with

the presence of toxigenic C. botulinum type C/D were lower Cl- (Wald's χ

2 = 4.54; p =

0.033) and higher %LOI (Wald's χ2

= 5.08; p = 0.024). These effects were observed in

the final model which included %LOI, Cl-, moisture, pH and NO3

-. The effect of Cl

- was

maintained across all locations (Fig. 3A), whereas the effect of %LOI was more marked

at Tablas de Daimiel (Fig. 3B).

During botulism outbreaks, the prevalence of C. botulinum type C/D was 18.2%

(4/22) in pools of aquatic invertebrates and 33.3% (6/18) in pools of necrophagous

Capítulo 2

75

invertebrates (Table 4). Positive aquatic invertebrate samples corresponded to two pools

of chironomid larvae from sediment and two pools of corixids from the water column.

Positive necrophagous invertebrate samples corresponded to two pools of adults, one

pool of pupae and three pools of maggots of Sarcophagidae and Calliphoridae flies

collected from or around bird carcasses.

The presence of C. botulinum type C/D was detected in the digestive tract

content of 38.7% of affected birds (Table 4). Within the positive birds, C. botulinum

was more frequently detected in the cecum samples (16/22 [73%]), followed by cloacal

swabs (4/7 [57%]), intestine (14/26 [54%]) and gastric content (10/29 [34%]) (Table S2

in the supplemental material). In positive birds for which several samples were

available, detection of C. botulinum was more frequent (p = 0.012) in cecum samples

(15/18 [83%]) than in gastric content samples (5/18 [28%]).

B

A

Fig. 3. Differences in physicochemical properties of sediments between samples in the absence

of Clostridium botulinum type C/D. A. Concentration of Cl- (Wald’s χ

2 = 4.54; p = 0.033). B.

Organic matter content (% loss on ignition) of sediments from Tablas de Daimiel (Wald's χ2

=

5.08; p = 0.024). dw, dry weight.

76

Table 4. Presence of Clostridium botulinum in different environmental samples taken from wetlands in Castilla-La Mancha between 2005 and 2008.

Wetland Outbreak years Sediment Benthic

invertebrates

Water column

invertebrates

Waterfowl

carcasses

Necrophagous flies

N +a % N +

b % N +

c % N + % N +

d %

Tablas de Daimiel 2007 93 6 6.5 3 0 0 - - - 11 4 36.4 - - -

Navaseca Lagoon 2008 14 0 0 7 1 14.3 6 2 33.3 24 7 29.2 10 2 20

Alcázar de San Juan

Lagoons

2006, 2008 37 4 10.8 - - - - - - 29 11 37.9 7 3 42.9

Manjavacas Lagoon - 9 0 0 - - - - - - - - - - - -

Pedro Muñoz Lagoons 2006 15 0 0 - - - - - - - - - - - -

Vega del Jabalon Reservoir 2005 21 2 9.5 - - - 6 1 16.7 11 7 63.6 1 1 100

Vicario Reservoir 2005 18 0 0 - - - - - - - - - - - -

Alle 207 12 5.8

A 10 1 10.0

AB 12 3 25.0

B 75 29 38.7

B 18 6 33.3

B

a All but two positive samples were collected during botulism outbreaks. b Positive benthic invertebrates were Chironomidae. c Positive water column invertebrates were

corixids. d Positive necrophagous flies were adults, pupae and larvae of Sarcophagidae and Calliphoridae. e Percentages of presence of C. botulinum were not significantly

different between sample types sharing a superscript capital letter.

77

Table 5. Physicochemical characteristics of sediments from wetlands in La Mancha.

Wetland

Zone

N

pH Moisture (%) Organic matter (%)a PO4

- (ppm)

a NO3

- (ppm)

a NO2

- (ppm)

a Cl

- (ppm)

a

Mean SE Mean SE Mean SE Mean SE Mean SE Mean SE Mean SE

Tablas de Daimiel 182 7.68AB

0.01 58.0C 1.0 17.9

B 0.8 21.44

ABC 1.75 369.0

ABC 21.2 2.41

A 0.67 1,263

A 138

Morenillo 36 7.60 0.03 57.0 3.3 20.3 1.0 39.36 4.69 548.0 83.1 3.34 1.01 1,132 179

Tablazo 70 7.72 0.02 49.8 1.1 8.5 0.3 10.96 1.94 339.8 21.9 3.39 1.65 1,133 193

Exhibit Lagoon 1 7.76 57.9 15.1 21.31 279.1 0.48 6,047

Permanent Lagoon 75 7.67 0.02 66.1 0.6 25.7 1.1 22.61 2.54 311.6 20.4 1.07 0.14 1,383 261

Alcázar S. Juan 30 8.31C 0.05 25.1

A 2.0 12.1

AB 0.9 28.18

ABC 5.92 371.5

ABC 39.5 4.58

A 1.47 34,987

C 6,058

La Veguilla 10 8.09 0.08 14.5 1.2 7.7 1.3 21.45 15.86 480.6 84.4 7.64 3.42 3,705 1,568

Las Yeguas 10 8.30 0.09 31.5 1.4 15.1 0.8 27.83 4.25 381.5 57.1 2.04 1.22 66,870 9,335

C. Villafranca 10 8.54 0.05 29.2 3.9 13.6 1.1 35.26 7.69 252.4 42.5 4.06 2.44 34,386 6,588

Manjavacas 10 8.43C 0.06 26.8

A 1.7 14.4

AB 1.6 35.42

BC 10.18 482.4

C 92.3 1.65

A 0.57 32,544

C 4,922

Pedro Muñoz 24 7.81B 0.05 38.2

B 3.3 16.5

B 1.1 43.07

C 12.04 427.7

BC 52.7 17.30

B 6.61 13,262

B 2,220

Pueblo 14 7.78 0.07 48.3 3.5 18.5 1.5 62.04 19.14 479.7 73.6 19.77 7.24 8,722 2,004

Retamar 10 7.84 0.07 24.1 2.4 13.6 1.1 16.50 3.70 354.8 71.2 13.83 12.62 19,619 3,794

Vega del Jabalón 20 8.50C 0.15 40.3

B 3.2 7.3

A 1.5 13.16

AB 6.51 183.1

A 17.2 0.36

A 0.09 414

A 133

Vicario 20 7.52A 0.07 44.4

B 1.9 8.3

A 0.4 8.16

A 2.66 249.1

AB 24.1 0.59

A 0.09 1,330

A 279

aDry weight (d.w.) basis; Means sharing a superscript capital letter were not significantly different between wetlands


78

4. Discussion

The present study shows that outbreaks of avian botulism have been regularly

observed over the last 30 years in the wetland area known as “Mancha Húmeda” in

central Spain, despite the relatively low occurrence of C. botulinum (5.8%) in sediment

samples. These outbreaks have affected around 20,000 birds from over 50 species

(mainly waterfowl, rallids and waders) and occurred especially when the mean

temperature in July was above 26 ºC. In parallel with the presence of C. botulinum, the

highest risk of botulism may occur in wetlands with lower salinity (low Cl- levels) and

high organic matter content.

Mouse bioassays performed at the Spanish Institute of Toxicology with

hexavalent antitoxin have confirmed the presence of BoNT in outbreaks that occurred

between 1998 and 2002. Subsequently, outbreaks that occurred up until 2009 have been

confirmed by mouse bioassay at the National Game Institute (IREC), Ciudad Real,

Spain, and samples taken during these outbreaks have been determined to be positive

both to the C antitoxin (C. botulinum antitoxin type C; catalog no. BS0611, lot 05-

0100, Centers for Disease Control and Prevention, Atlanta, GA, USA) and to the type D

antitoxin in the Institute Pasteur in all cases. In addition, some field samples were

positive for the type C/D mosaic which suggests that C. botulinum producing avian

botulism in Mancha Húmeda is probably due to this type (as is the case in other parts of

Europe [Woudstra et al., 2012]). Negative results using PCR in a few samples that were

positive by qPCR can be explained by the lower sensitivity inherent in conventional

PCR compared to qPCR, and also because the threshold cycles (CTS) in the qPCR were

later (data not shown). The present work has been focused on the detection of C.

botulinum rather than the presence of the neurotoxin. The qPCR has proved to be a

Capítulo 2

79

sensitive tool for the detection of C. botulinum in the environment and its

ecoepidemiological study.

In general, the wild birds most frequently affected by botulism are waterfowl

and shorebirds (Rocke and Friend, 1999; Rocke, 2006; Friend, 2002). In our study,

69.3% of registered mortality corresponded to the Anatidae family, and 12.6% to

shorebird species (Scolopacidae, Recurvirostridae and Charadridae). The mallard was

the most affected species, and represented 50% of the reported mortality; the same

proportion as observed by Woo et al. (2010) in an outbreak that occurred in Korea in

2008. In addition, Shayegani et al. (1984) reported high percentages for Anseriformes

(56%) and lower percentages for shorebirds (6.6%) in mortalities caused by botulism in

New York State. The mallard duck is one the most abundant species in wetlands of our

study area and elsewhere, and therefore, it commonly suffers losses during botulism

outbreaks (Rocke, 2006; Shayegani et al., 1984). Outbreaks of botulism are an

especially significant conservation issue when they affect endangered species with

limited local or global distribution. In such cases, isolated population hotspots are

highly sensitive to catastrophic events such as unusual weather events or disease

outbreaks. For example, a single botulism outbreak produced an estimated die-off of 15-

20% of the western metapopulation of American white pelican (Pelecanus

erythrorhynchos) (Rocke et al., 2005), and another in Taiwan caused the death of 73

black-faced spoonbill (Platalea minor), while global populations are now estimated at

only 1,600 mature individuals (IUCN, 2012; Chuang et al., 2005). In another event, 181

critically endangered Laysan ducks (Anas laysanensis) died during a botulism outbreak

at Midway Atoll (Hawaii), out of a global population of approximately 500-680 mature

individuals (Work et al., 2010; IUCN, 2012). It should be noted that threatened species

such as the endangered white-headed duck, were also found dead during the botulism


80

outbreaks reported here (Table S1) despite the scarcity of the species in the studied

wetlands. Although the Spanish population of this species has increased from less than

100 birds in 1978 to around 2,200 birds in 2007, in Ciudad Real province (where most

of our sampling sites were located), the September 2007 census recorded only 139 birds

(Torres-Esquivias, 2008). The world population for this species has been estimated to

be between just 7,900 and 13,100 individuals (around 5,300 – 8,700 mature individuals

[IUCN, 2012]) and is in decline. Botulism may therefore be a major concern in terms of

conservation efforts aimed at this species.

In principle, an avian botulism outbreak is essentially unpredictable, but, it is

now known that various environmental factors play a predisposing role in epidemics.

These factors include temperature, salinity of the substrate, pH, redox potential (of the

surface water and soil/sediment porewater), dissolved oxygen level and sediment/soil

organic matter content (Babinszky et al., 2008; Rocke and Samuel, 1999; Murphy et al.,

2000). Moreover, large epidemic outbreaks are favored by the presence of botulism

intoxicated avian carcasses and the maggots that feed on them. This acts to amplify the

number of intoxicated birds as they feed on BoNT bearing maggots, in a process known

as the carcass-maggot cycle (Wobeser, 1997). This cycle is favored by temperatures

above 20 ºC which facilitates the growth of C. botulinum in the bird carcasses (Soos and

Wobeser, 2006; Rocke and Bollinger, 2007). As observed here, the majority of

outbreaks recorded in La Mancha Húmeda wetlands started in July and correlated with

mean temperatures above 26 ºC in this month. The temperature in July frequently

reached 40 ºC during the day within the study period, which is optimal for the growth of

C. botulinum type C in an appropriate substrate (Rocke and Bollinger, 2007). In this

regard, global warming may increase the risk of a botulism outbreak in the area. Natural

temporary wetlands would probably be affected by persistent drought whereas artificial

Capítulo 2

81

wetlands, such as lagoons receiving treated wastewater, may persist as the only habitat

for waterbirds. Rising temperatures may increase the frequency of botulism outbreaks

by reducing the number of low risk saline habitats and favoring the growth of C.

botulinum itself.

In Castilla-La Mancha we have rarely observed botulism outbreaks in spring or

autumn, as reported in some wetlands in America (Rocke and Friend, 1999; Wobeser et

al., 1983), Europe (Hubálek and Halouzka, 1991) and Asia (Woo et al., 2010). The only

registered case in our dataset was an outbreak observed in Navaseca lagoon, which

started at the end of September 2008, when there was a mean temperature of just 20.5

ºC. The cause of this episode is still unknown. The outbreak began just after a short

period of heavy rain, which exceeded the carrying capacity of the wastewater treatment

plant that feeds treated water into this lagoon. Further research is necessary to

understand the possible epidemiological association between wastewater,

enteropathogens and botulism outbreaks, since many of the botulism epidemics in our

study area occurred in wetlands that receive significant inputs from wastewater

treatment plants. A feasible hypothesis is that some bacteria of fecal origin could

initially cause mortality of a few birds. The onset of several botulism outbreaks has

indeed been associated with previous bird mortalities due to other causes, i.e., due to

starvation, bacterial or parasitic infections, predation or pesticide poisoning (Woo et al.,

2010; Soos and Wobeser, 2006). In turn, this may initiate the carcass-maggot cycle

within the optimal environment offered by the decomposing carcass. The likelihood of

this happening may be heightened after a high rainfall storm event when relatively

untreated sewage may be flushed through the briefly overburdened wastewater

treatment plant.


82

Detection rates for C. botulinum type C in the soils/sediments analysed in our

study area (5.8%) were similar to those observed in other affected wetlands in Spain

(1.7 to 18% [Contreras de Vera et al, 1987; Contreras de Vera et al, 1991]) and Florida

(5.6% [Marion et al., 1983]). However, these values were far lower than in other

wetlands in Austria (74 to 83% [Zechmeister et al., 2005]), California (52% [Sandler et

al., 1993]), Canada (38% [Wobeser et al., 1987]) or the UK (19.4 to 51.5% [Smith et

al., 1982]). The marked seasonality of many Mediterranean wetlands may reduce the

persistence of C. botulinum in sediments. For example, Sandler et al. (1993) found that

the presence of C. botulinum in marshes that remained flooded was higher than in

marshes that were drained in the spring and flooded in the fall. Other factors, such as the

high salinity prevailing in most of the La Mancha Húmeda wetlands may also affect the

long-term presence of C. botulinum in sediments. We have observed a clear negative

association between soluble Cl- levels in sediments and the detection of C. botulinum.

Likewise, other studies have reported a negative effect of salinity on C. botulinum

growth (Segner et al., 1971; Webb et al., 2007) and botulism occurrence (Rocke and

Friend, 1999). Further, the highest risk of occurrence for avian botulism outbreaks has

been associated with a soil pH value between 7 and 8 (Rocke and Samuel, 1999). We

have not observed a significant effect of pH on the presence of C. botulinum in the

sediments studied here, but most of our observed values were within this cited range of

risk. Another important factor (not studied here) is redox potential. Negative values for

this parameter, indicative of reducing/low oxygen conditions in the sediment, have been

associated with a higher risk of a botulism outbreak (Rocke and Samuel, 1999).

Wetlands studied here tended to have a positive redox potential, but this may be lower

in lagoons fed by wastewater treatment plants or locally near wastewater outfalls as a

result of the higher input of fresh organic matter/nutrients (Hijosa-Valsero et al., 2012).

Capítulo 2

83

Wetlands that receive treated wastewater may therefore pose a higher risk for botulism

initiation because they may tend to be more affected by eutrophication (which may

induce reducing sedimentary conditions) or provide a substrate (by causing the death of

a bird by other means) for toxin production. The continuous unnatural water

input/influx may also remove the key annual drought period and reduce salinity

compared to other temporal wetlands.

Invertebrates, mainly maggots from necrophagous flies, play a crucial role in

botulism outbreaks as vehicles for the BoNT toxin which then causes mortality in the

birds feeding on them (Wobeser, 1997). Hubálek and Halouzka (1991) analyzed various

invertebrates during a botulism outbreak, and detected BoNT at high concentrations in

necrophagous larvae and pupae of the blow flies Lucilia sericata and Calliphora

vomitoria which were collected from bird carcasses. In turn, the risk of mortality due to

avian botulism tends to be higher in wetlands with higher densities of maggot-laden

carcasses (Evelsizer et al., 2010b). Duncan and Jensen (1976) compared the toxicity of

different invertebrate species collected from or near carcasses, and again found that

Calliphoridae larvae (collected from carcasses) pose the greatest risk. Toxicity was also

analyzed in adult invertebrate forms, and 4 out of 15 samples of Calliphoridae flies were

toxin positive. We have detected C. botulinum type C/D not only in larvae and pupae,

but also in adults of Calliphoridae and Sarcophagidae flies. The presence of the bacteria

in the adult fly provides a new aspect to be considered in the epidemiology of avian

botulism, since these flies may be actively transporting C. botulinum type C/D from one

carcass to another.

Other invertebrates collected around carcasses, such as ptychopterid fly larvae,

leeches and sow bugs, have been shown to contain BoNT, albeit at concentrations that

were lower than in blowfly larvae (Duncan and Jensen, 1976; Hubálek and Halouzka,


84

1991). During mass mortalities of waterbirds produced by C. botulinum type E in North

America, benthic invertebrates have been identified as potential vectors of spores

(Pérez-Fuentetaja et al., 2011). Here, we detected C. botulinum in samples of

chiromonids and corixids that were collected around bird carcasses, but their potential

risk as carriers of toxin seems to be limited (Duncan and Jensen, 1976).

The overall prevalence of C. botulinum in the digestive tract of bird carcasses

collected during botulism outbreaks was 38.5%, and it was more frequently detected in

the lower tract (bowel or cecum) than in the upper tract (gastric content). This

difference in distribution may reflect the preference of C. botulinum type C/D for the

lower tract (especially the cecum) for postmortem growth of the bacteria. Alternatively,

it may reflect its premortem prevailing presence. The presence of C. botulinum type C

in the digestive tract of birds can be explained by the ingestion of vegetative cells and/or

spores (Haagsma, 1991); furthermore, the bacteria could persist in the ceca of healthy

birds where it may act as a substrate for toxin production after death (Zhu et al., 2002).

We have noted that cloacal swabs can give similar results to cecum samples in terms of

detecting the presence of C. botulinum type C/D. This may indicate that cloacal swabs

could be a specimen of choice in live birds suspected of botulism poisoning, or could be

used to study possible carriers of the microorganism in epidemiological studies.

Overexploitation of groundwater resources in the agricultural land around the La

Mancha Húmeda wetlands has completely changed their natural water regime. Tablas

de Daimiel, which was historically a regionally important permanent wetland, currently

undergoes extended periods of drought. In contrast, other historically temporary saline

lagoons have now been transformed into permanent freshwater lagoons due to the

continuous input provided by wastewater treatment plants. Navaseca is one such

artificial lagoons. Our analysis of its physicochemical characteristics indicates that it

Capítulo 2

85

represents a significant risk in terms of its potential to host/induce local botulism

outbreaks which may then be disseminated by vectors to nearby wetlands like Tablas de

Daimiel National Park, where the highest numbers of birds concentrate and where the

greatest implication for certain endangered avian species may exist.

Acknowledgments

We thank Victor Diez for information provided regarding botulism outbreaks

recorded by the personnel of the JCCM. We also appreciate the cooperation of staff

from the Tablas of Daimiel National Park and of the Environmental Agents from

Castilla-La Mancha (JCCM). Finally we also thank Elena de Prada for help with sample

collection at the Wildlife Rehabilitation Centre of “El Chaparrillo”. This study was

granted by the Spanish Ministry of Environment (OAPN 099/2003 and OAPN

035/2009). Dolors Vidal was supported with a JAE DOC contract from the Spanish

Council of Research (CSIC). Mark Taggart was supported by a Juan de la Cierva

Fellowship from the Spanish Ministry of Science and Innovation (MICINN). Ibone

Anza was supported by a JAE PRE grant from CSIC and Elisa Pérez-Ramírez was

supported by a I3p grant from CSIC. We thank the Department of Bacteriology of the

National Veterinary Institute in Uppsala and the Unit of Anaerobic Bacteria and Toxins

of the Pasteur Institute in Paris for their receptivity and collaboration during two stays

of Ibone Anza at these institutions.


86

References

Álvarez-Cobelas, M., Cirujano, S. 1996. Las Tablas de Daimiel. Ecología Acuática y

Sociedad. Organismo Autónomo de Parques Nacionales, Ministerio de Medio

Ambiente, Madrid, Spain, p. 368.

Babinszky, G., Csitári, C., Józsa, S. 2008. Observations on environmental factors in

connection with avian botulism outbreaks in a Hungarian wetland habitat. Acta

Microbiologica et Immunologica Hungarica 55, 455–464.

Borland, E.D., Moryson, C.J., Smith, GR. 1977. Avian botulism and the high

prevalence of Clostridium botulinum in the Norflok Broads. Veterinary Record

100, 106–109.

Chuang, W.C., Shieh, Y.C., Chen, S.H., Lee, Y.F., Tsai, K.Y., Tsai, S.S. 2005.

Outbreaks of botulism due to type C1 toxin in black-faced spoonbills (Platalea

minor). Taiwan Veterinary Journal 31, 267-273.

Cirujano, S., Medina, L. 2002. Plantas acuáticas de las lagunas y humedales de Castilla-

la Mancha. In Cirujano S, Medina L. (ed), Real Jardín Botánico, CSIC and Junta

de Comunidades de Castilla-La Mancha, Madrid, Spain, p. 340

Contreras de Vera, A., García Fernández, A., Cubero Pablo, M.J., León-Vizcaíno, L.

1991. Low prevalence of C. botulinum in Spanish wetlands with a tidal regime.

Veterinary Record 128, 187–188.

Contreras de Vera, A., León-Vizcaíno, L., Carranza Guzmán, J., Hermoso de Mendoza,

M., Garrido Abellán, F. 1987. Botulismo aviar en zonas húmedas de la campiña

de Sevilla y Córdoba. Medicina Veterinaria 4, 173-179.

Dohms, J.E., Cloud, S.S. 1982. Susceptibility of broiler chickens to Clostridium

botulinum type C toxin. Avian Diseases 26, 89–96.

Capítulo 2

87



Diseases 12, 116–126.

Evelsizer, D.D., Bollinger, T.K., Dufour, K.W., Clark, R.G. 2010a. Survival of radio-

marked mallards in relation to management of avian botulism. Journal of

Wildlife Diseases 46, 864–877.

Evelsizer, D.D., Clark, R.G., Bollinger, T.K. 2010b. Relationships between local

carcass density and risk of mortality in molting mallards during avian botulism

outbreaks. Journal of Wildlife Diseases 46, 507–513.

Friend, M. 2002. Avian disease at the Salton Sea. Hydrobiologia 473, 293–306.

Haagsma, J. 1991. Pathogenic anaerobic bacteria and the environment. Revue

Scientifique et Technique de L’Office International des Epizooties 10, 749-764.

Hijosa-Valsero, M., Sidrach-Cardona, R., Bécares, E. 2012. Comparison of interannual

removal variation of various constructed wetland types. Science of the Total

Environment 430, 174-183.

Hubálek, Z., Halouzka, J. 1991. Persistence of Clostridium botulinum type C toxin in

blow fly (Calliphoridae) larvae as a possible cause of avian botulism in spring.

Journal of Wildlife Diseases 27, 81–85.

IUCN. 2012. IUCN Red List of Threatened Species (ver. 2012.1). Available at:

http://www.iucnredlist.org. (Accessed: 12 March 2013).

León-Quinto, T., de la Vega, A., Lozano, A., Pastor, S. 2004. Summer mortality

of waterbirds in a Mediterranean wetland. Waterbirds 27, 46–53.

Lindberg, A., Skarin, H., Knutsson, R., Blomqvist, G., Båverud, V. 2010. Real-time

PCR for Clostridium botulinum type C neurotoxin (BoNTC) gene, also covering

http://www.iucnredlist.org/


88

a chimeric C/D sequence-application on outbreaks of botulism in poultry.


Marion, W.R., O’Meara, T.E., Riddle, G.D., Berkhoff, H.A. 1983. Prevalence of

Clostridium botulinum type C in substrates of phosphate-mine settling ponds and

implications for epizootics of avian botulism. Journal of Wildlife Diseases 19,

302–307.

Mitchell, W.R., Rosendal, S. 1987. Type C botulism: the agent, host susceptibility, and

predisposing factors. In Eklund, W., Dowell, V.R.Jr. (eds). Avian botulism: an

international perspective, Charles C. Thomas, Springfield, Illinois, USA. p 55-

71.


2000. Algal toxins – Initiators of avian botulism? Environmental Toxicol.ogy

15, 558-567.

Peck, M.W. 2009. Biology and genomic analysis of Clostridium botulinum. Advanced

Microbial Physiology 55, 183–265.


Clostridium botulinum type E in Lake Erie: Inter-annual differences and role of

benthic invertebrates. Journal of the Great Lakes Research 37, 238-244.

Rocke, T., Converse, K., Meteyer, C., Mclean, R.G. 2005. The impact of disease in the

American white pelican in North America. Waterbirds 28 (Special Publication

1), 87-94.


C.A., Stroud, D.A. (eds). Waterbirds around the world, The Stationery Office,

Edinburgh, UK. p 422-426.

Capítulo 2

89

Rocke, T.E., Bollinger, T.K. 2007. Avian botulism. In Thomas, N.J., Hunter, D.B.,

Atkinson, C.T. (eds). Infectious diseases of wild birds, Wiley-Blackwell, Ames,

Iowa, USA, p 377-416.

Rocke, T.E., Friend, M. 1999. Avian botulism, In Friend, M., Franson, J.D. (eds). Field

manual of wildlife disease. General procedures and diseases of birds, USGS

National Wildlife Health Center, Washington, USA. p 271-281.



1249-1260.





Sandler, R.J., Rocke, T.E., Samuel, M.D., Yuill, T.M. 1993. Seasonal prevalence of

Clostridium botulinum type C in sediments of a northern California wetland.


Segner, W.P., Schmidt, C.F., Boltz, J.K. 1971. Enrichment, isolation, and cultural

characteristics of marine strains of Clostridium botulinum type C. Applied

Microbiology 22, 1017–1024.

Shayegani, M., Stone, W.B., Hannett, G.E. 1984. An outbreak of botulism in waterfowl

and fly larvae in New York State. Journal of Wildlife Diseases 20, 86–89.





90

Smith, G.R., Oliphant, J.C., White, W.R. 1982. Clostridium botulinum type C in the

Mersey estuary. Journal of Hygiene 89, 507–511.






Torres-Esquivias, J.A. 2004. Malvasía cabeciblanca, Oxyura leucocephala. In Madroño,

A., González, C., Atienza, J.C. (eds). Libro Rojo de las Aves de España.

Dirección General para La Biodiversidad-SEO/BirdLife, Madrid, Spain.

Torres-Esquivias, J.A. 2008. La malvasía cabeciblanca. In Ballesteros, G., Cabrera, M.,

Echevarrías, J.L., Lorenzo, J.A., Raya, C., Torres-Esquivias, J.A., Viedma, C.

(eds). Tarro Canelo, cerceta pardilla, porrón pardo, malvasía cabeciblanca y

focha moruna en España. Población en 2007 y método de censo. SEO/BirdLife,

Madrid, Spain. p 54-69.



waterbird and sediment samples: comparison with other PCR techniques.


Villalba, E.J., Haagsma, J., Díaz, E.J., Gasca, A. 1989. Niveles de contaminación por

Clostridium botulinum y sus toxinas en diferentes hidrohábitats del Parque

Nacional de Doñana. Medicina Veterinaria 6, 559-561.

Webb, M.D., Pin, C., Peck, M.W., Stringer, S.C. 2007. Historical and contemporary

NaCl concentrations affect the duration and distribution of lag times from

Capítulo 2

91

individual spores of nonproteolytic Clostridium botulinum. Applied and

Environmental Microbiology 73, 2118-2127.

Wobeser, G. 1988. Effects of botulism on ducks drinking saline water. Journal of

Wildlife Diseases 24, 240–245.

Wobeser, G. 1997. Avian botulism – Another perspective. Journal of Wildlife Diseases

33, 181–186.

Wobeser, G., Galmut, E.A. 1984. Internal temperature of decomposing duck carcasses

in relation to botulism. Journal of Wildlife Diseases 20, 267–271.

Wobeser, G., Marsden, S., MacFarlane, R.J. 1987. Occurrence of toxigenic Clostridium

botulinum type C in the soil of wetlands in Saskatchewan. Journal of Wildlife

Diseases 23, 67–76.

Wobeser, G., Rainnie, D.J., Smith-Windsor, T.B., Bogdan, G. 1983. Avian botulism

during late autumn and early spring in Saskatchewan. Journal of Wildlife

Diseases 19, 90–94.

Woo, G.H., Kim, H.Y., Bae, Y.C., Jean, Y.H., Yoon, S.S., Bak, E.J., Hwang, E.K., Joo,

Y.S. 2010. Outbreak of botulism (Clostridium botulinum type C) in wild

waterfowl: Seoul, Korea. Journal of Wildlife Diseases 46, 951–955.








3120-3127.


92

Zechmeister, T.C., Kirschner, A.K., Fuchsberger, M., Gruber, S.G., Suess, B.,



environmental samples from low and high risk avian botulism areas. ALTEX 22,

185–195.

Zhu, X.Y., Zhong, T., Pandya, Y., Joerger, R.D. 2002. 16S rRNA-based analysis of

microbiota from the cecum of broiler chickens. Applied and Environmental


93

Supplemental material

Table S1. Official mortality rates of birds species due to avian botulism outbreaks in wetlands of Castilla-la Mancha between 1978 and 2008.

Family Bird species (cont) 1978 1998 1999 2002 2004 2005 2006 2008 Total

Podicipedidae Podiceps cristatus 7 7

Podiceps nigricollis 61 2 63

Tachybaptus ruficollis 22 3 1 26

Podiceps sp 3 3

Ardeidae Ardea cinerea 2 37 2 1 1 43

Ardea purpurea 18 1 19

Ardeola ralloides 3 3

Bubulcus ibis 8 39 1 48

Egretta alba 1 1

Egretta garzetta 14 271 1 1 287

Ixobrychus minutus 6 6

Nycticorax nycticorax 2 8 1 11

Ciconiidae Ciconia ciconia 1 3 1 4 4 9 22

Phoenicopteridae Phoenicopterus ruber 3 2 5

Anatidae Anas acuta 67 1 68

Anas clypeata 888 7 47 31 31 1,004

Anas crecca 637 37 13 107 41 835

Anas penelope 3 3

Anas platyrhynchos 933 168 8127 46 339 478 79 10,170

94

Family (cont) Bird species (cont) 1978 1998 1999 2002 2004 2005 2006 2008 Total (cont)

Anas querquedula 11 11

Anas strepera 34 1361 1 8 5 18 1,427

Aythya ferina 98 71 2 2 173

Aythya nyroca 1 1

Netta rufina 82 3 85

Oxyura leucocephala 1 5 2 8

Tadorna tadorna 1 1 2

Accipitridae Buteo buteo 1 1

Circus aeruginosus 4 1 5

Phasianidae Alectoris rufa 1 1

Rallidae Fulica atra 345 587 750 3 32 35 112 16 1,880

Gallinula chloropus 2 16 75 2 6 3 104

Rallus rallus 1 25 26

Recurvirostridae Himantopus himantopus 307 191 38 11 15 6 16 2 586

Recurvirostra avossetta 206 13 219

Charadridae Charadrius alexandrinus 66 66

Charadrius dubius 95 95

Charadrius hiaticula 40 1 41

Vanellus vanellus 376 7 6 1 1 2 393

Scolopaciae Actityis hypoleucos 7 1 8

Calidris alpina 51 51

Calidris canutus 6 6

Calidris ferruginea 163 163

95

Family (cont) Bird species (cont) 1978 1998 1999 2002 2004 2005 2006 2008 Total (cont)

Calidris minuta 296 296

Gallinago gallinago 75 2 1 6 84

Limosa limosa 75 75

Philomachus pugnax 275 19 2 296

Tringa glareola 2 2

Tringa nebularia 12 1 13

Tringa ochropus 4 1 2 7

Tringa totanus 115 115

Glareolidae Glareola pratincola 1 1

Laridae Larus michahellis 1 1

Larus ridibundus 316 343 117 15 4 2 797

Larus spp 65 65

Sternidae Chlidonias hybridus 19 18 37

Chlidonias niger 7 7

Gelochelidon nilotica 34 1 1 36

Sterna nilotica 60 60

Sterna albifrons 1 1

Sterna hirundo 3 3

Tytonidae Tyto alba 1 1

Laniidae Lanius senator 1 1

Passeriformes Calandrella brachydactila 4 4

Columbidae Columba libia 1 1

Total 5,763 1390 10,980 42 170 548 780 206 19,879


96

Table S2. Samples analyzed in botulism positive birds by outbreak and wetland.

Year Site Bird

reference

Larvae Gastric

content

Intestine Caecum Cloacal

swab

2005 Jabalón BOT32 - - +

BOT33 - - +

BOT34 + +

BOT35 + +

BOT38 - +

BOT39 - +

BOT40 + -

2006 Alcázar A66/07 + +

A117/07 + - +

2007 Tablas A244/07 - - +

A235/07 - - +

A238/07 - +

A237/07 + -

2008 Alcázar A 136/08 + -

A144/08 - +

A145/08 + - +

A146/08 + - -

Cig 16 - + -

Focha 13 + - + +

Reidora 6 - - + +

Reidora 7 - + +

Reidora 8 + - + +

Navaseca A08 188 - - + +

A08 196 + - - -

A08 201 - + + +

A08 211 - - + +

A09 001 - + - -

A09 003 - + + +

A09 006 - + - -

97

CAPÍTULO 3

Eutrofización y bacterias patógenas como factores de riesgo de

botulismo aviar en humedales que reciben efluentes de

estaciones depuradoras de aguas residuales

Explosión de Lemna spp en la Laguna de Navaseca. Fotografía de Rafael Mateo

Anza, I., Vidal, D., Laguna, C., Díaz-Sánchez, S., Sánchez, S., Chicote, A., Florín, M.,

Mateo, R. 2014. Eutrophication and bacterial pathogens as risk factors for avian botulism

outbreaks in wetlands receiving effluents from urban wastewater treatment plants. Applied

and Environmental Microbiology 80, 4251-4259.


98

Eutrofización y bacterias patógenas como factores de riesgo de botulismo aviar en

humedales que reciben efluentes de estaciones depuradoras de aguas residuales.

RESUMEN

Debido a la escasez de agua en la reserva de la biosfera de “La Mancha-Húmeda”, el uso de

aguas residuales ha sido propuesto como solución para la conservación de humedales

naturales amenazados. Además, las depuradoras de agua de muchos pueblos de la región

vierten sus efluentes en lagunas naturales cercanas. El botulismo aviar parece ser más

frecuente en esas lagunas por lo que hipotetizamos que los patógenos aviares presentes en

las aguas residuales pueden causar mortalidades de aves acuáticas que desencadenen los

brotes de botulismo. Para comprobarlo, muestreamos durante un año 24 puntos distribuidos

en tres humedales, dos que reciben aguas residuales y uno control que no las recibe

directamente. En cada punto recogimos sedimentos, agua, heces de aves e invertebrados y

los analizamos para Escherichia coli (APEC), Salmonella spp., Clostridium perfringens

tipo A y Clostridium botulinum tipo C/D. También determinamos varios parámetros

fisicoquímicos de sedimento y agua. En general, la presencia de APEC, C. perfringens y C.

botulinum fue significativamente mayor en muestras de los humedales que reciben aguas

residuales. El inicio de un brote en la laguna de Navaseca durante el periodo de estudio

coincidió con altas temperaturas en el agua y alta demanda biológica de oxígeno, un bajón

en el potencial redox del agua, en los niveles de clorofila a y de sulfato, y un incremento en

el carbono inorgánico. La mayor frecuencia de C. botulinum en las heces de aves recogidas

en Navaseca en el momento previo al brote indica que existen aves portadoras del bacilo y

Capítulo 3

99

resalta la importancia de que se produzca un brote si estas mueren (por cualquier causa

como por ejemplo enfermedades bacterianas) y C. botulinum comience a producir toxina en

sus cadáveres.


100

Eutrophication and bacterial pathogens as risk factors for avian botulism outbreaks

in wetlands receiving effluents from urban wastewater treatment plants

ABSTRACT

Due to the scarcity of water resources in the “Mancha Húmeda” Biosphere Reserve, the use

of treated wastewater has been proposed as a solution for the conservation of natural

threatened floodplain wetlands. In addition, wastewater treatment plants of many villages

pour their effluent into nearby natural lakes. We hypothesized that certain avian pathogens

present in wastewater may cause avian mortalities which would trigger avian botulism

outbreaks. With the aim of testing our hypothesis, 24 locations distributed in three

wetlands, two that receive wastewater effluents and one serving as a control, were

monitored during a year. Sediment, water, waterbird faeces, and invertebrates were

collected for the detection of putative avian pathogenic Escherichia coli (APEC),

Salmonella spp., Clostridium perfringens type A and Clostridium botulinum type C/D.

Also, water and sediment physicochemical properties were determined. Overall, APEC, C.

perfringens and C. botulinum were significantly more prevalent in samples belonging to the

wetlands which receive wastewater. The occurrence of a botulism outbreak in one of the

studied wetlands coincided with high water temperatures and sediment 5-day biochemical

oxygen demand (BOD5), a decrease in water redox potential, chlorophyll a, and sulfate

levels, and an increase in water inorganic carbon levels. The presence of C. botulinum in

bird faeces before the onset of the outbreak indicates that carrier birds exist and highlights

Capítulo 3

101

the risk of botulinum toxin production in their carcasses if they die by other causes such as

bacterial diseases, which are more probable in wastewater wetlands.


102

1. Introduction

Water management is an essential aspect for the sustainable development of semi-

arid Mediterranean regions like “La Mancha Húmeda” Biosphere Reserve in the Central

Spanish Plateau where recent drought periods have stressed the balance between crop

irrigation and the conservation of wetlands (Martínez-Santos et al., 2008) such as Las

Tablas de Daimiel National Park, the most representative Spanish floodplain ecosystem

(Álvarez-Cobelas et al., 2001; Fornés et al., 2000). In this situation of growing water

scarcity, the use of treated wastewater has been proposed for the maintenance of Tablas de

Daimiel National Park and to conserve its biodiversity (Navarro et al., 2011). Within this

region, many wastewater treatment plants already spill their effluents into natural lakes due

to the absence of rivers near villages and also to maintain waterbird populations. On the one

hand, these wastewater lakes provide permanent resting and breeding areas for many

species of waterbirds, including endangered species as the white-headed duck (Oxyura

leucocephala), but on the other hand, pouring wastewaters has modified the ecology of the

lakes in many ways, decreasing salinity, increasing eutrophication, and attenuating their

natural hydrological cycles of drought-flooding periods (Florín and Montes, 1999).

Moreover, this practice constitutes a health risks for birds because improperly treated

effluents are an important source of pollutants and microorganisms, including avian

bacterial pathogens (Benskin et al., 2009; Okafor, 2011). A recent study revealed the role

of invertebrates living on sewage filter beds as vectors of environmental pollutants that can

affect immune function, neural development, and behavior in male starlings (Sturnus

vulgaris) (Markman et al., 2008). Previous research linked the deaths of brown pelicans

Capítulo 3

103

(Pelecanus occidentalis) with the presence of pathogenic clostridia on raw sewage

discharges (Ankerberg, 1984). Later on, enterocolitic bacteria, mainly Salmonella, were

isolated from up to 58% of sick or dead waterbirds collected during the summer in a

Mediterranean wetland (León-Quinto et al., 2004). Strikingly, avian botulism outbreaks in

“La Mancha Húmeda” frequently occur in lakes supplied with effluents from wastewater

treatment plants (Vidal et al., 2013).

Avian botulism is an intoxication produced by botulinum neurotoxins (BoNTs)

which results in a flaccid paralysis of the muscles and the death of the affected birds.

BoNTs are exotoxins produced by Clostridium botulinum, a strictly anaerobe spore-

forming bacteria which is present in the sediments of wetlands and in the digestive tracts of

waterbirds and fishes (Nol et al., 2004; Rocke, 2006). There are seven confirmed types of

BoNTs (A-G); the most frequent in Europe is the mosaic type C/D (Woudstra et al., 2012;

Anza et al., 2014). High water temperatures and increases in the invertebrate biomass,

which frequently occur in wastewater ponds, may attract waterbirds for feeding and provide

optimal conditions for the occurrence of botulism outbreaks, although there is still not

enough evidence to support this hypothesis (Murray and Hamilton, 2010). Other factors

such as pH between 7.5 and 9, low redox potential (Eh), decreasing turbidity, and low

salinity also contribute to botulism risk in wetlands (Rocke and Samuel, 1999; Murray and

Hamilton, 2010; Vidal et al., 2013). Avian mortalities due to any cause have the potential

to be a major initiating factor of botulism outbreaks because they provide carcasses for the

initial multiplication and toxinogenesis of C. botulinum (Soos and Wobeser, 2006). In this

framework, urban wastewater that enters the wetlands has to be considered a potential


104

source of avian pathogenic bacteria that may cause mortalities on a few waterbirds, with the

risk of initiating a botulism outbreak affecting larger numbers of individuals.

With this study, we aim (1) to evaluate the risk for waterbirds derived from the

presence of pathogenic bacteria in wetlands that receive wastewater and (2) to study

possible changes on the ecological characteristics of the wetlands produced by wastewater

and how these changes may favour the presence of C. botulinum type C/D and the

outbreaks.


2.1 Study area.

The study area included wetlands located in “La Mancha Húmeda” Biosphere

Reserve, a region situated in south-central Spain that covers a total surface of 25,000 ha

(Fig. 1). The climate in this area (≈600 m above sea level) is cold-temperate continental,

with a pronounced dry season and average annual rainfall between 400 to 500 mm. Within

this region, we monitored three wetlands affected to different degrees by the effluent from

urban wastewater treatment plants as follows (in the order of least to most affected): Tablas

de Daimiel National Park (TDNP), Veguilla lake, and Navaseca lake. TDNP is a floodplain

located in the junction of Cigüela and Guadiana rivers with a maximum flooded surface of

1.675 ha (Álvarez-Cobelas and Cirujano, 1996). This wetland occasionally receives the

input of poorly treated wastewater from towns located upstream. Navaseca lake (24.3 ha) is

located in the vicinity of TDNP (at a distance about 6.5 km). This lake was seasonal in the

past, but now it is permanently flooded and highly eutrophic because it receives the

Capítulo 3

105

effluents of the wastewater treatment plant of Daimiel town. Veguilla lake (128 ha) is a

semi-artificial saline and seasonal wetland included in the complex of Alcázar de San Juan

Natural Reserve (695 ha). It receives discontinuous inputs from the wastewater treatment

plant of Alcázar de San Juan town with the purpose of maintaining waterbirds breeding

populations. The effluent is alternatively discharged into a floodplain at the junction of

Záncara and Cigüela rivers, especially in summer, when the lake is naturally desiccated to

avoid avian botulism outbreaks. There is a landfill near Veguilla where some bird species

that inhabit the lagoon [i.e, gulls [Larus sp.] and white storks [Ciconia ciconia]) usually

feed. Botulism is endemic in this region, and in the last 20 years, outbreaks have occurred

in the three studied wetlands being more frequent in Veguilla and Navaseca lakes (Vidal et

al., 2013).

Spain

Fig. 1. Location of the three studied wetlands, wastewater treatment plants and the nearby towns.


106

2.2 Field sampling and data collection.

Each wetland was sampled on seven occasions from April 2010 to February 2011.

In each visit, samples of surface and interstitial water, sediment, aquatic invertebrates,

carrion flies and waterbird faeces were collected. Samplings were performed once per

season in spring (April), autumn (November), and winter (February), and monthly during

summer (June-September), when botulism outbreaks are more likely. An additional

sampling visit to Navaseca lake was performed during the onset of a botulism outbreak

(Fig. 2).

Fig. 2. Diagram of the data collection and analysis

Capítulo 3

107

Water and sediment samples were collected in 12 sampling stations in TDNP, 6 in

Navaseca and 6 in Veguilla. Sampling stations were broadly distributed within each

wetland shore to obtain a wide coverage. Sediment samples were collected from the upper

5 cm at 3 random positions with a metal core sampler 7 cm in diameter, and pooled

subsamples were kept in plastic bags with zip closure. Interstitial water was collected in

three 15-ml vacuum tubes, each one with Rhizom soil moisture samplers (Eijkelkamp

Agriserch Equipment). Approximately 1,500 ml of surface water were collected per site,

and 300 ml of it was filtered in the field with Whatman GF/C filters (GE Healthcare Ltd.)

in order to preserve its stability against biogeochemical changes until processing in the

laboratory. Filtered material was weighed to calculate the seston (total and volatile solids),

and filtered water was used for the analysis of nutrients (NO2-, NO3

-, NH4

+, PO4

3-), total

organic carbon (TOC), and major ions (SO42, Cl

-, Ca

2+, Na

+, K

+, Mg

2+), while gross surface

water was used for 5-day biochemical oxygen demand (BOD5) and alkalinity

determinations. Besides, three replicate measurements of temperature, redox potential (Eh),

pH, dissolved oxygen, chlorophyll a, turbidity and conductivity of surface water were taken

in situ with a Hydrolab®

DS5X multiprobe (Hach Hydromet). Water depth was measured

with a stiff meter (Fig. 2). Water and sediment samples were maintained in dark conditions

at 4 °C until processing in the laboratory so as to avoid alterations. During the summer,

water samples could not be collected from some stations within TDNP and Veguilla

because they were dry.

Aquatic invertebrates and carrion flies were collected in the same sampling stations.

Aquatic invertebrates were captured from the water with a sieve of 0.5-mm-pore-size mesh

and kept alive in sterile plastic containers. Carrion flies were captured using homemade


108

cone traps that were hung on the shore vegetation of the wetlands for 24 h. After that time,

the traps were closed, taken to the laboratory and frozen to kill the trapped flies. Aquatic

invertebrates and flies were identified and pooled according, at least, to the taxonomic

family. Samples of aquatic invertebrates included specimens of non-biting midge larvae

(Chironomidae), water boatmans (Corixidae), back swimmers (Notonectidae), crustaceans

(Ostracoda, Copepoda and Cladocera), bladder snails (Physidae) and beetle larvae

(Coleoptera). Samples of flies included specimens of the families Calliphoridae,

Sarcophagidae, Ephydridae, Anthomyiidae, Muscidae and Ulidiidae.

Fresh waterbird faeces (n=30) were collected on each wetland per sampling visit.

Before samples were taken, the distribution of waterbirds on the shore of the wetlands was

observed in order to assign the faeces collected in each site a taxonomic group. The

samples were collected under aseptic conditions using sterile swabs and plastic bags.

Additionally, gull faeces were also collected in a landfill beside Veguilla on May 2010

(Fig. 2). The sampled families included Anatidae (ducks and geese), Rallidae (rails),

Scolopacidae (waders), Laridae (gulls), Ciconiidae (storks), Phoenicopteridae (flamingos)

and Ardeidae (herons).

2.3 Chemical analysis of water and sediment samples.

Sediment samples were analyzed for water and organic matter content (loss on

ignition, LOI), pH, and conductivity following standardized procedures (de Caluwe and van

Logtestijn, 1998). BOD5 was measured with an OxiTop system (WTW). Surface water

samples were analyzed for total and volatile solids, BOD5, total alkalinity, NO2-, NH4

+,

Capítulo 3

109

PO43-

, SO42-

, Cl-, Ca

2+, Na

+, K

+ and Mg

2+ following colorimetric methods and NO3

- with

an ion-selective electrode (Metrohm), and inorganic, organic and total carbon levels were

measured with a total organic carbon analyzer (TOC-VCSN, Shimadzu) (Golterman and de

Graaf, 1992; APHA, 1998). The same parameters were determined in interstitial water

samples, except total and volatile solids, alkalinity and BOD5 (Fig. 2).

2.4 Microbiological analysis.

Microbiological analysis included three avian bacterial pathogens associated with

wastewater and C botulinum type C/D. The avian bacterial pathogens were avian

pathogenic Escherichia coli (APEC), Salmonella spp. and C. perfringens type A (Benskin

et al., 2009; Murray and Hamilton, 2010). For APEC detection in sediment and faeces,

samples were streaked directly onto McConkey agar plates (Scharlau) and incubated at 37

°C for 24 h. For surface water, 100-ml samples were filtered through a 0.45-µm-pore-size

filter (Millipore) using a filter holder manifold and glass filter holders (Nahita; Auxilab),

and then the filter was placed into 9 ml of buffered peptone water (BPW) broth (Scharlau)

and incubated at 37 °C for 24 h; afterwards, 1 ml was streaked onto McConkey agar plates.

Isolation and identification of APEC were performed by multiplex PCR following a

method previously described (Johnson et al., 2008; Díaz-Sánchez et al., 2013). Briefly, an

initial gross screening of APEC was done in the growth from the first streaking area of the

culture plate so as to discard negative samples. The presence of APEC was tested by

multiplex PCR for the following five virulence genes highly conserved among APEC

isolates: the aerobactin siderophore receptor gene (iutA), the episomal increased serum


110

survival gene (iss), the episomal outer membrane protease gene (ompT), the putative avian

haemolysin gene (hlyF), and the salmochelin siderophore receptor gene (iroN). In

accordance with Johnson et al. (2008), E. coli isolates can be considered APEC when they

contain at least 4 of these 5 genes. DNA was extracted by boiling 10 µl of the first streaking

area into 200 µl sterilized ultrapure water for 5 min, the solution was centrifuged at 12,000

× g 5 min, and the supernatant was used as PCR template. Afterwards for each PCR-

positive culture, 10 individual E. coli-like colonies obtained from the MacConkey agar

plates were tested again for the presence of the 5 virulence genes and were considered

putative APEC when harbouring at least four. The resulting putative APEC isolates were

confirmed biochemically as E. coli by the API 20E system (bioMérieux) (Fig. 2).

Detection of Salmonella spp. was done according to international official

standardized procedures (ISO, 2002). Briefly, samples of sediment and faeces were pre-

enriched in 9 ml of Rappaport-Vassidialis (RV) broth (Oxoid) and incubated aerobically for

48 h at 42 °C. Surface water was analyzed using the same filtered water used for APEC,

and 1 ml of the BPW broth was passed to 9 ml RV broth. At 24 and 48 h, 1 ml of the

culture in RV broth was streaked onto a XLT4 agar (Biokar diagnostics) plates and

incubated 24 h at 37 °C. The resulting suspected isolates were confirmed biochemically to

be Salmonella spp. by the use of a API 20E system (bioMérieux) (Fig. 2).

For the detection of Clostridium perfringens type A (containing the cpa -α-toxin

gene), sediment and faeces samples were directly streaked onto tryptose sulphite

cycloserine agar (TSCA) (Scharlau). For surface water, 100-ml samples were filtered

through a 0.45-µm-pore-size filter (Millipore) which was placed directly onto TSCA plates.

All the samples were then incubated anaerobically in an anaerobe container system (BD

Capítulo 3

111

GasPakTM 129 EZ) at 37 °C for 48 h. Suspected individual black colonies were streaked

onto a new TSCA plate and incubated as described before. Then, six toxin genes (cpa -α-

toxin-, cpb -β-toxin-, cpb2 -β2-toxin-, etx -e-toxin-, iap -ι-toxin- and cpe -enterotoxin) were

detected using the PCR assay described by van Asten et al. (2009) and colonies containing

the α-toxin gene were classified as C. perfringens type A. Only the samples collected

during the first three sampling visits were tested for C. perfringens.

Sediments, surface water (as processed for APEC), aquatic invertebrates, fly pools,

and bird faeces were processed for detection of C. botulinum type C/D as previously

described by Vidal et al (2011). Briefly, samples were cultured in 9 ml of commercial

cooked meat broth supplemented with vitamin K1, glucose and hemin (BD BBL Cooked

meat medium with glucose, hemin and vitamin K) using an anaerobe container system (BD

GasPakTM 129 EZ) over a period of 3 to 5 days at 40 °C. DNA was extracted by boiling

the pellet obtained from 1 ml of the culture broth in 300 µl of distilled water. The solution

obtained after centrifugation 12,000 × g 5 min was used as PCR template. Real-time PCR

was performed according to Sánchez-Hernández et al. (2008) (Fig. 2). This PCR assay

amplifies genes encoding both type C and type C/D mosaic toxins, but as we have

confirmed the presence in the study area of the mosaic type C/D whereas we have not

detected type C (Vidal et al., 2013; Anza et al., 2014), we assumed that type C/D is the

causative agent. Furthermore, the mosaic type prevails in avian botulism outbreaks in

Europe (Woudstra et al., 2012) and the botulism outbreak that occurred in Navaseca was

confirmed as type C/D by the mouse bioassay.


112

2.5 Statistical analysis.

Mean values of physicochemical parameters from sediments and water were

compared among wetlands with one-way analyses of variance (ANOVA) tests. Post-hoc

differences were studied with the least significant differences (LSD) test. The frequency of

detection of the four pathogens in sediment, water, aquatic invertebrates, fly pools, and bird

faeces from the three wetlands were compared by the chi-square tests or Fisher’s exact

probability tests. Associations between the presence of APEC, C. perfringens and C.

botulinum and the physicochemical characteristics of water and sediments were studied

using generalized linear models (GLM) with a binary logistic distribution. The number of

samples positive to Salmonella spp. in sediments and water was too low to be included in

this analysis. The absence or presence of the bacteria (negative or positive) was used as the

dependent variable, while the physicochemical characteristics of sediments and water as

predictors and zone (wetland) and season as fixed factors. Physicochemical characteristics

that had less than 150 observations for models of C. botulinum and APEC and less than 70

for C. perfringens were not included in the GLM models so as to guarantee a minimum

sample size. Non-normally distributed variables were transformed to logarithms (log10)

values to fulfill the normality requirements of parametric tests. The distribution of the four

pathogens (including Salmonella spp.) in bird faeces was also studied with GLM using

“wetland”, “season” and “bird family” as fixed variables and the presence of each pathogen

as dependant variable. Corrected Akaike’s Information Criteria (AICc) was used to

compare alternative models (Burnham and Anderson, 2002). To select the best model, all

possible combinations of fixed effects were compared using the “dredge” function (Barton,

2011), and models with differences of less than 2 AICc points from the best value (ΔAICc

Capítulo 3

113

= 0) were considered to have the same empirical support (Burnham and Anderson, 2002).

The level of significance of the tests was established at p<0.05. The analyses were

conducted with IBM SPSS Statistics 19 program and R 2.12.2 (R Core Team 2010; used

only for AICc).

3. Results

3.1 Physicochemical parameters of water and sediment.

Most of the physicochemical parameters measured in surface water significantly

differed among wetlands (Table 1). Navaseca and Veguilla showed signs of eutrophication

and degradation due to the input of treated wastewaters as indicated by a higher turbidity,

total and volatile solids, BOD5, total carbon, and NH4+ and PO4

3- concentrations. In

addition, Navaseca showed higher levels of chlorophyll a and dissolved oxygen and lower

water Eh. Veguilla revealed the highest values of conductivity, Cl-, SO4

2-, K

+, Na

+ and

Mg2+

, due to the natural salinity present in this area. Analogous trends were observed for

the parameters measured in interstitial water and sediment (Table 2). In addition, NO3-

concentration in interstitial water was higher in the lakes receiving treated wastewater.

3.2 Prevalence of avian pathogenic bacteria and C. botulinum type C/D.

The prevalence of APEC, C. perfringens type A and C. botulinum type C/D

observed in most environmental samples were considerably higher in Navaseca and

Veguilla than in TDNP (Table 3). APEC was mainly present in waterbird faeces (16.9 to

35.6%); C. perfringens was widely distributed in water (16.7 to 62.5%), sediment (11.1 to


114

83.3%), and waterbird faeces (59.9 to 90.4%); C. botulinum mainly appeared in sediment

samples (2.4 to 20.8%) and Salmonella spp. in a small number of faeces collected in

Veguilla (3.6%).

In the gull faeces collected from the landfill close to Veguilla, we detected the

highest prevalences of Salmonella (30%) and APEC (37%) and the lowest of C.

perfringens type A (30%), while C. botulinum type C/D was absent. The observed

prevalence of C. perfringens and APEC in waterbird faeces from the three wetlands

significantly differed among birds taxa. The highest prevalence of C. perfringens was

detected in faeces of Laridae (80.5%), Anatidae (70.5%) and Rallidae (70%) and the

highest prevalence of APEC in faeces of Ciconidae (61.9%). Finally, though differences

were not significant, Salmonella spp. appeared more frequently in faeces of Laridae (3.5%)

and Ciconiidae (9.5%) and C. botulinum in faeces of Rallidae (2.9%; Table 4).

Capítulo 3

115

Table 1. Physicochemical parameters of surface water from three wetlands differing in affection by

wastewater (Navaseca the most and TDNP the least). The values are based on data collected during 8

visits throughout one year.

Wetland

Navaseca Veguilla TDNP

Parameters N Meana SD N Mean

a SD N Mean

a SD P

Maximum depth

(cm) 12 29.5

A 3.53 18 25.2

B 3.29 29 41.0

A 3.92 0.01

Tº (ºC) 48 21.8A 8.14 38 17.6

B 7.41 78 19.1

AB 7.37 0.03

Conductivity

(µS/cm) 48 3662

B 917 38 9876

A 14470 78 2447

B 833 <0.01

pH 45 8.29A 0.39 36 8.23

A 0.56 78 7.84

B 0.82 <0.01

Redox potential

(Eh) (mV) 48 281

96.22 38 327

98 78 309 117 0.13

Chlorophyll a

(µg/L) b

48 128A 111 37 27.3

B 46.1 76 19.8

B 44.4 <0.01

Turbidity (NTU) b 42 108

A 157 32 83.2

A 102 67 56.1

B 104 <0.01

Oxygen saturation

(%) 48 158

A 109 38 120

B 80.9 77 95.7

B 61.7 <0.01

Volatile solids

(mg/L) 24 46.5

A 33.5 24 51.1

A 92.5 39 7.12

B 6.72 <0.01

Total solids (mg/L) b

24 58.1A 41 24 137

A 271 39 13.3

B 12.2 <0.01

BOD5 (mg/L) 18 35.2A 16.9 12 44.9

A 37.1 22 6.45

B 9.91 <0.01

Inorganic carbon

(mg/L) 21 109

A 45.6 25 103

A 52 39 46.9

B 18.1 <0.01

Total organic carbon

(mg/L) 21 20.9 29.2 25 27.7 37.3 39 15.5 13.8 0.21

Total carbon (mg/L) 21 124A 26.4 25 129

A 41 39 61.3

B 17.1 <0.01

Carbonate alkalinity

(meq/L) 13 0.82

B 0.14 13 1.23

A 0.61 11 0.35

C 0.17 <0.01

Total alkalinity

(meq/L) 24 9.12

A 1.11 25 8.71

A 3.25 39 3.72

B 0.91 <0.01

N-NH4+(mg/L)

b 24 2.95

A 3.08 25 36.6

A 90.3 39 0.43

B 1.68 <0.01

N-NO2- (mg/L)

b 24 0.02

0.02 25 0.07

0.11 39 0.04 0.08 0.64

N-NO3- (mg/L)

b 21 4.91

A 4.6 21 5.65

A 7.76 34 3.03

B 3.55 <0.01

P-PO43-

(mg/L) b 24 1.64

A 0.95 25 0.60

B 0.74 39 0.03

C 0.11 <0.01

SO42-

(meq/L) b 24 9.28

C 5.83 23 69.3

A 80.9 39 22.7

B 8.31 <0.01

Cl- (meq/L) 24 17.3

B 8.68 25 38.1

A 62.7 37 3.35

B 2.33 <0.01

Ca2+

(meq/L) 9 9.94B 2.38 12 11.2

B 3.39 18 14.7

A 3.72 <0.01

Na+ (meq/L) 9 12.8

AB 8.56 12 23.9

A 36.0 18 2.16

B 0.69 0.02

Mg2+

(meq/L) 9 9.51B 4.86 12 102

A 153 18 13.8

B 7.46 0.02

K+ (meq/L) 9 0.42

B 0.19 12 2.09

A 1.50 18 0.07

B 0.04 <0.01

a Means sharing a superscript capital letter were not significantly different between wetlands.

b Factors transformed into logarithm for the ANOVA analysis.


116

Table 2. Physicochemical parameters of interstitial water and sediment from three wetlands differing

in affection by wastewater (Navaseca the most and TDNP the least). The values are based on data

collected during 8 visits throughout one year.

Wetland


Parameters N Meana SD N Mean

a SD N Mean

a SD P

Inorganic carbon (mg/L) 48 103B

59 38 134A

101 79 83.7B

56.5 0.02

Total organic carbon (mg/L) 48 77.9

78.2 38 72.2

49.2 79 72.4

49.8 0.86

Total carbon (mg/L) 48 181AB

94.7 38 204A 93.6 79 155

B 84.9 0.02

N-NH4+

(mg/L)b 48 7.71

A 10.5 37 6.64

AB 10.5 79 3.33

B 6.91 <0.01

N-NO2- (mg/L)

+ 48 0.02

0.02 38 0.03

0.05 78 0.02

0.02 0.94

N-NO3- (mg/L) 36 8.11

A 4.46 28 9.97

A 8.39 56 4.42

B 4.74 <0.01

P-PO43-

(mg/L) +

48 2.92A

3.08 38 2.59A

2.79 79 0.42B

0.58 <0.01

SO42-

(meq/L) 48 8.35C

4.39 36 80A

82.7 79 28.4B

14.2 <0.01

Cl- (meq/L)

+ 41 22.8

A 5.69 35 35.0

A 35.2 78 7.31

B 10.3 <0.01

Ca2+

(meq/L) 18 9.59C

2.12 18 17.23B

7.46 36 22.2A

9.22 <0.01

Na+ (meq/L) 18 21.6

B 6.73 18 40.2

A 35.9 36 4.43

C 6.58 <0.01

Mg2+

(meq/L) 18 13.0B

7.46 18 120A

166 36 25.5B

27.5 <0.01

K+ (meq/L) 18 0.46

B 0.20 18 2.45

A 1.72 36 0.14

B 0.16 <0.01

pH c 48 8.22

A 0.42 44 8.25

A 0.32 84 7.89

B 0.27 <0.01

Conductivity (µS/cm) bc

42 558B

323 38 2233A

2764 72 909B

818 <0.01

BOD5 (mg/g)c 33 14.4

A 10 28 11.5

AB 8.83 56 8.39

B 3.91 <0.01

Water content (%)c 47 31.1

A 37.9 44 15.2

B 12.1 83 15.9

B 9.61 <0.01

LOI (%)c 46 1.42

B 0.9 44 1.79

A 1.13 83 1.87

A 0.74 0.02

aMeans sharing a superscript capital letter were not significantly different between wetlands.

bFactors that have been transformed into logarithm for the ANOVA analysis.

cParameters of the sediment.

117

TABLE 3 Presence of three avian pathogens and C. botulinum type C/D in environmental samples taken from three wetlands differing in affection

by wastewater (Navaseca is the most and TDNP the least affected). An avian botulism outbreak occurred in Navaseca during the study period.

Avian pathogens

Wetland


N + % N + % N + %

C. botulinum type C/D

Sediment 48 10 20.8* 42 8 19.0

* 84 2 2.4

Water 47 3 6.4* 38 0 0 79 0 0

Faeces 215 8 3.7* 192 1 0.5 248 0 0

Aquatic invertebratesa 26 2 7.7 26 0 0 51 0 0

Fliesa 42 2 4.5 20 0 0 72 0 0

C. perfringens type A

Sediment 18 14 77.8* 18 15 83.3

* 4 36 11.1

Water 17 8 47.0* 16 10 62.5

* 6 36 16.7

Faeces 83 75 90.4*†

76 47 61.8 110 56 59.9

E.coli (APEC)

Sediment 48 5 10.4* 42 2 4.76 84 1 3.8

Water 47 6 12.8 38 1 2.63 79 3 1.2

Faeces 205 73 35.6* 192 59 30.7

* 248 42 16.9

Salmonella spp.

Sediment 48 0 0 42 0 0 84 1 1.2

Water 47 1 2.1 38 0 0 79 0 0

Faeces 205 2 0.9 192 7 3.6* 248 1 0.4

aAquatic invertebrates and flies were grouped in pools

*Prevalence significantly higher than in TDNP (p<0.05)

†Prevalence significantly higher than in Veguilla (p<0.05)


118

Table 4. Prevalence of three avian pathogens and C. botulinum type C/D in faeces of different bird

families collected in three wetlands year round.

Avian family

E. coli (APEC) C. perfringens

type A

Salmonella

spp

C. botulinum

type C/D

N + %a N + %

a N + % N + %

Anatidae 231

81 35B

104 73 70.2A

231 3 1.3 231 2 0.9

Rallidae 192 39 20.3C

50 35 70A

192 1 0.5 202 6 2.9

Laridae 57 10 17.5C

41 33 80.5A 57 2 3.5 57 0 0

Scolopacidae 101 18 17.8C

50 22 44B

101 1 1 101 0 0

Ciconiidae 21 13 61.9A

5 1 20B

21 2 9.5 21 0 0

Phoenicopteridae 10 2 20C

0 0 0 10 0 0 10 0 0

Ardeidae 18 6 33.3ABC

4 3 75AB

18 0 0 18 0 0

a Percentages sharing a superscript capital letter were not significantly different between bird families

3.3 Parameters associated with bacteria occurrence.

Regression models with ΔAICc<2 revealed an association between several

environmental factors and the presence of the studied bacteria in the wetlands (Table 5).

Taking into account just the significative values (p<0.05), APEC was less present in faeces

from TDNP. Moreover, the presence of APEC in faeces was higher from spring to autumn,

and it was more frequent in Ciconiidae faeces than in other bird families. The observed

prevalence of Salmonella spp. was also lower in bird faeces from TDNP. Furthermore, C.

perfringens was less frequent in water samples from TDNP, while in sediment samples it

was positively associated with SO42-

levels. In faeces, C. perfringens prevalence was lower

during the summer than in spring and it was more present in Navaseca than in TDNP. In

sediment samples C. botulinum was less frequent in TDNP. Also, it was positively

associated with chlorophyll a levels and negatively correlated with conductivity of surface

water (Table 5).

Capítulo 3

119

3.4 Physicochemical parameters associated with the botulism outbreak in Navaseca.

Before the onset of the outbreak, we observed a period of maintained high water

temperatures (28.5 ± 0.3 °C), associated with high levels of chlorophyll a concentrations

and high sediment BOD5. At the same time, we observed abrupt changes affecting several

environmental parameters that may have triggered the outbreak (Fig. 2). One of the first

changes observed was a decrease in water Eh, followed by the increase in concentration of

inorganic carbon in interstitial water. Then, the chlorophyll a concentration decreased

sharply along with the sulfate concentration in interstitial water and sediment BOD5 (Fig.

2). Coinciding with these changes, C. botulinum type C/D was first detected in sediments

and its occurrence in bird faeces experienced a peak; later, during the botulism outbreak, it

was also detected in surface water samples and Calliphoridae flies and, after the peak of the

outbreak, in aquatic snails, coleopteran larvae and Ephydridae flies (Fig. 3).

120

Table 5. Regression models of the presence of the four avian pathogens in different samples based on AICc. Models with differences of less than 2 AICc points

from the best (ΔAICc = 0) were considered to have the same empirical support.

Avian pathogen Sample Model

C. botulinum type C/D Sediment Zone [TDNP (-3.43)] + season + water conductivity (-0.001) + chlorophyll a (+1.13) + PO4

3- (-1.02)

Faeces Zone + season

C. perfringens type A

Sediment Zone + inorganic carbon (-0.03) + organic carbon (+0.04) + LOI (-2.70) + pH(+9.56 )+ SO42-

(+0.21) + NH4+ (+2.58) + PO4

3-

(-1.58)

Water Zone [TDNP (-3.01)]+ season + conductivity (-5*10-3

) + temperature (+0.19) + chlorophyll a (-1.13) + turbidity (+1.34) + pH

(+0.90)

Faeces Zone [Navaseca (+1.48) + TDNP (-0.96)] + season [summer (-1.26)]

E.coli (APEC)

Sediment Zone + inorganic carbon (-0.02) + organic carbon (+0.001) + LOI (-1.3)

Water Zone [TDNP (-1.94)] + temperature (-0.18) + chlorophyll a (-0.81)

Faeces Zone [TDNP (-1.28)] + season [autumn (+1.37) + spring (+1.16) + summer (+0.82)] + bird family[Ciconiidae (+0.93) + Laridae

(-1.07) + Scolopacidae (-0.79) + Rallidae (-0.69)]

Salmonella spp. Faeces Zone [TDNP (-2.23)]

In bold are factors and variables that have a significative effect (p<0. 05) and in ( ) are the average estimates of the effects.

Full model for C. botulinum type C/D and APEC in sediment: zone + season + water temperature +water conductivity + water redox + log water chlorophyll a + log interstitial water PO43-+

interstitial water SO42-+ interstitial inorganic carbon +interstitial organic carbon + sediment pH+ sediment LOI. Reference zone is Navaseca.

Full model for APEC in water: zone + season + water temperature + water conductivity +water redox + log water chlorophyll a + water dissolved oxygen. Reference zone is Navaseca.

Full model for C.perfringens in sediment: zone +season+ log interstitial water NH4++log interstitial water PO4

3- + interstitial water Cl-+ interstitial water SO42- + interstitial water Mg2+ + interstitial

inorganic carbon +interstitial organic carbon + sediment pH+ sediment LOI.

Full model C. perfringens in water: zone + season+ water temperature + water conductivity +water redox + water pH + log water chlorophyll α +log water turbidity. Reference zone is Navaseca and

reference season spring.

Full model for faeces: zone (wetland) + season + bird type. Reference zone is Veguilla, reference season is winter and reference bird type is anatidae.

Capítulo 3

121

Fig. 2. Changes in environmental parameters in Navaseca lake that could have favored the avian

botulism outbreak in summer 2010. The arrows indicate the beginning and the ending of the

botulism outbreak, presented as mean +/- standard error of data from 6 sampling points.


122

Fig. 3. Presence of C. botulinum type C/D in different environmental samples collected in

Navaseca lake during 8 sampling visits. The arrows indicate the beginning and the ending of the

botulism outbreak.

4. Discussion

The spill of treated wastewater has produced changes in the studied wetlands

that can facilitate the onset of avian botulism outbreaks. These changes included

eutrophication (i.e. Navaseca and Veguilla) due to the regular input of nutrients which

led to the development of anaerobic environments that favoured the presence of C.

botulinum type C/D. Moreover, the wetlands receiving treated wastewater showed

higher prevalences of avian pathogenic bacteria (i.e., APEC and C. perfringens type A)

that can kill a small number of birds and therefore provide carcasses which are an

Capítulo 3

123

optimum substrate for the initial growth of C. botulinum prior to an outbreak. In

addition, these eutrophic wetlands have high phytoplankton and zooplankton

productivity from spring to autumn that attract a great amount of waterbirds, which

increases spatial aggregation and the risk of epidemics (Murray and Hamilton, 2010;

Cardoni et al., 2011). The result of this has been a higher frequency of botulism

outbreaks in Navaseca (4 summer outbreaks in the last 5 years) and Veguilla (5

recorded outbreaks since 1978) than in TDNP (only one large outbreak in 1999 and

another smaller in an exhibition pond in 2007) (Vidal et al., 2009; Vidal et al., 2013).

Wastewater discharges in wetlands modify their hydroperiod, soil pH and Eh,

nutrient load and plant communities (Cooke et al., 1990; Mason, 2002; Foulquier et al.,

2013; Sánchez, 2013). In our study area, we have observed higher turbidity, chlorophyll

a, total and volatile solids, BOD5, total carbon, NH4+

and PO43-

concentrations and

lower water Eh in the wetlands with an input of treated wastewater. The issue is how

these changes can increase the risk of botulism outbreaks. Our results suggest that high

water temperatures (especially during the summer) and eutrophication in Navaseca lake

caused an overgrowth of phytoplankton before the outbreak, as revealed by high

concentrations of chlorophyll a recorded in June and early July. Later, we observed an

overgrowth of floating duckweed (Lemna minor), which covered the surface of the lake

during the seconds half of July. The lack of light and resources resulting of this

overgrowth may have caused the death of the phytoplankton, as indicated the sharp

decreases of Eh and chlorophyll a. Moreover, the death phytoplankton could sink into

the sediments and the resulting organic matter may have encouraged the overgrowth of

microorganisms depleting the oxygen, as reported elsewhere (Díaz and Rosenberg,

2008). Further supporting evidence for this conjecture are the high inorganic carbon

concentration and the decrease of the SO42-

concentration recorded in interstitial water


124

between July and August which may have been a consequence of the metabolism of

microorganisms (i.e. methanogenesis) and the activity of anaerobic sulfate-reducing

bacteria (Baird, 1999; Jouanneau et al., 2014). Also, the sharp decrease on the BOD5

levels reflected that microorganisms had consumed organic matter with the consequent

oxygen depletion. This anoxic environment could be suitable for the growth of C.

botulinum type C/D, which was first detected in the sediments of Navaseca in July

coinciding with the cited changes. Later, C. botulinum was also detected in water and in

necrophagous invertebrates (i.e. Calliphoridae flies and beetle larvae), probably due to

its ability to grow in other compartments such as carcasses. Moreover, we found a

significant association between sampling sites with high concentrations of chlorophyll a

and the presence of C. botulinum type C/D in the sediments, which may indicate that

this pathogen prevails better in eutrophicated sites. Other authors have also observed

links between botulism and changes in environmental characteristics of wetlands that

can be due to eutrophication. Murphy et al. (2000) found that a switch in the water Eh

in Whitewater Lake (Canada) might have been a significant factor in the development

of C. botulinum type C in its sediments. Rocke et al. (1999) found that increasing

temperature and biomass may influence the initial phase of botulism outbreaks, and that

these were more frequent in wetlands with lower Eh. More recently, Lan Chun et al.

(2013) found that the macrophytic green alga Cladophora provides habitat for C.

botulinum type E and that its accumulation in near shore waters coincided with high

incidence of avian botulism in the shoreline.

The proliferation of C. botulinum type C/D in sediments can increase the

chances of birds ingesting spores either directly from the sediments (Beyer et al., 2008)

or along with detritivorous aquatic invertebrates, such as snails. In our study, this is

supported by the increase in the detection of C. botulinum type C/D in bird faeces

Capítulo 3

125

before the occurrence of the outbreak in July. After the death of any of these carrier

birds, their carcasses may become substrate for further proliferation and toxinogenesis

of C. botulinum type C/D prior to an outbreak, which would later propagate by the

carcass-maggot cycle (Wobeser, 1997). The presence of avian pathogens in wetlands

can facilitate this process by causing sudden mortalities of waterbirds and may be one

of the reasons that explain the regular botulism outbreaks that occur in wastewater lakes

where the prevalence of pathogens is higher. Bird mortalities have already been

described as the major initiating factor of outbreaks in Eyebrow Lake, Canada (Soos

and Wobeser, 2006). In our study, APEC and C. perfringens type A, both capable of

producing bird mortalities (Ankerberg, 1984; Benskin et al., 2009; Díaz-Sánchez et al.,

2013), were significantly more frequent in sediment and bird faeces from the two

wetlands that receive effluents from wastewater treatment plants (i.e. Navaseca and

Veguilla). In addition, C. perfringens type A is a good indicator of sewage discharges

(Skanavis and Yanko, 2001; Mason, 2002), so the high prevalence observed indicates

the presence of poorly treated wastewater in Navaseca and Veguilla which probably

contains other pathogens not included in this study, like Campylobacter spp.,

Aeromonas spp., or Pseudomonas spp. (Al-Bahry et al., 2009; Benskin et al., 2009). As

an example, E. coli and Proteus mirabilis were isolated from the heart of a white-

headed duck collected during the outbreak in Navaseca. Also, in a recent bird mortality

that occurred in another lake receiving wastewater, Pseudomonas aeruginosa was

isolated from the heart of a coot (Fulica atra) (own unpublished data, IREC). As further

evidence, a discharge of wastewater in the Salada lagoon (south of Spain) was

associated with a waterbird mortality due to Pasteurella anatipestifer (Gómez, 1987).

Finally, C. botulinum type C/D was also more frequent in the sediments

collected from Navaseca and Veguilla, which was probably related to the higher


126

frequency of outbreaks in these wetlands (Vidal et al, 2009; Vidal et al, 2013). In this

sense, Wobeser et al. (1987) found a strong association between a prior history of

botulism in a wetland and the proportion of soil samples containing C. botulinum type

C. Our regression analysis showed that the most important factor explaining the

presence of the avian pathogens was the zone (wetland), more than the physicochemical

parameters, the season, or the type of bird sampled. It is probable that other variables

not studied here, such as bird aggregation, the amount of wastewater entering the

wetlands or the water retention time had an effect on the prevalence of pathogens.

The proximity of landfills to wetlands may suppose an additional risk for the

appearance of outbreaks because opportunistic birds feeding urban waste, such as gulls

or storks, may spread pathogens such as Salmonella spp., Campylobacter spp. or C.

botulinum from landfills where they feed (Ortiz and Smith, 1994; Benskin et al., 2009;

Ramos et al., 2010) to wetlands where they roost. Accordingly, we observed the major

prevalence of Salmonella spp. in bird faeces (mainly in gulls and storks) of Veguilla,

which can be related with the high prevalence of Salmonella spp. detected in gull faeces

in a nearby landfill (30%). The higher prevalence of APEC observed in Ciconiidae

(white storks) faeces also supports this statement.

5. Conclusions

Inefficiently treated effluents from wastewater treatment plants represent a risk

for the conservation of wetland ecosystems. During the dry season, these wetlands still

maintain water with high phytoplankton and zooplankton productivity thus attracting a

great amount of waterbirds, including endangered species such as the white-headed

duck. The eutrophication and high loads of avian pathogens that are found in these

Capítulo 3

127

wetlands may increase the risk of botulism outbreaks which, in this situation of

aggregation, can have a severe impact on waterbird populations due to the high

mortality rates produced in short periods of time (Rocke, 2006; Work et al., 2010).

Waterbirds attracted by these eutrophic wetlands may be exposed to diverse pathogens,

urban or industrial pollutants with unknown effects for them (Markman et al., 2008;

Murray and Hamilton, 2010). Improvements on water-treatment plants and the

elimination of “by-pass” systems that directly pour wastewater on wetlands are urgent

measures to guarantee the conservation of waterbirds.

Acknowledgments

We thank Miguel Carles-Tolrá for helping with the identification of the fly

families. We also thank Jordi Feliu, Alicia B. Gómez and Adelaida Chicampol for their

assistance in the field work, and David Sánchez for his help with the interpretation of

the results. This study was supported by the Spanish Ministry of Environment (grants

OAPN 035/2009). I. Anza was supported by a JAE PRE grant from Spanish Council of

Research (CSIC); Dr. D. Vidal was supported with a JAE DOC contract from the CSIC;

S. Díaz-Sánchez held a PhD research grant funded by the Junta de Comunidades de

Castilla–La Mancha (JCCM) (AG07). Dr. S. Sánchez acknowledges the Consejería de

Educación y Ciencia de la Junta de Comunidades de Castilla–La Mancha and Fondo

Social Europeo for his research fellowship (09/02-C).

References

Al-Bahry, S.N., Mahmoud, I.Y., Al-Belushi, K.I.A., Elshafie, A.E., Al-Harthy, A.,

Bakheit, C.K. 2009. Coastal sewage discharge and its impact on fish with


128

reference to antibiotic resistant enteric bacteria and enteric pathogens as bio-

indicators of pollution. Chemosphere 77, 1534–1539.

Álvarez-Cobelas, M., Cirujano, S., Sánchez-Carrillo, S. 2001. Hydrological and

botanical man-made changes in the Spanish wetland of Las Tablas de Daimiel.

Biologial Conservation 97, 89-98.

Álvarez-Cobelas, M., Cirujano, S. 1996. Las Tablas de Daimiel. Ecología acuática y

sociedad. Organismo Autónomo Parques Nacionales, Ministerio de Medio

Ambiente, Madrid, Spain.

Ankerberg, CWJr. 1984. Pelican deaths in the vicinity of a sewage lift station a

bacteriological investigation. Microbios Letters 101, 33-42.

Anza, I., Skarin, H., Vidal, D., Lindberg, A., Båverud, V., Mateo, R. 2014. The same

clade of Clostridium botulinum strains is causing avian botulism in southern and

northern Europe. Anaerobe 26, 20-23.

APHA. 1998. Standard methods for the examination of water and waste water, 20th

ed.

Published jointly by American Public Health Association, American Water

Works Association, and Water Environment Federation, Washington DC.

Baird, C. 1999. Environmental chemistry, 2nd

ed. W. H. Freeman & Company,

Basingstoke, UK.

Barton, K. 2011. MuMIn: Multi-model inference. R package version 1.6.1.

http://cran.r_proyect.org/package=MuMIn

Benskin, C.M., Wilson, K., Jones, K., Hartley, I.R. 2009. Bacterial pathogens in wild

birds: a review of the frequency and effects of infection. Biological Reviews 84,

349-373.

http://cran.r_proyect.org/package=MuMIn

Capítulo 3

129

Beyer, W.N., Perry, M.C., Osenton, P.C. 2008. Sediment ingestion rates in waterfowl

(Anatidae) and their use in environmental risk assessment. Integrated

Environmental Assessment and Management 4, 246-251.

Burnham, K.P., Anderson, D.R. 2002. Model selection and multimodel inference: a

practical information-theoretic approach, 2nd

ed. Springer-Verlag, New York,

NY

Cardoni, D.A., Isacch, J.P., Fanjul, M.E., Escapa, M., Iribarne, O.O. 2011. Relationship

between anthropogenic sewage discharge, marsh structure and bird assemblages

in an SW Atlantic saltmarsh. Marine Environmental Research 71, 122-130.

Cooke, J.G., Cooper, A.B., Clunie, N.M.U. 1990. Changes in the water, soil, and

vegetation of a wetland after a decade of receiving a sewage effluent. New

Zealand Journal of Ecology 14, 37-47.

de Caluwe, H., van Logtestijn, R. 1998. Method Manual – Landscape Ecology – Utrecht

University.

Díaz, R.J., Rosenberg, R. 2008. Spreading dead zones and consequences for marine

ecosystems. Science 321: 926.

Díaz-Sánchez, S., López, A., Gamino, V., Sánchez, S., Ewers, C., Höfle, U. 2013. A

colibacillosis outbreak in farmed red-legged partridges (Alectoris rufa) Avian

Diseases 57, 143-146.

Florín, M., Montes, C. 1999. Functional analysis and restoration of Mediterranean

lagunas in the Mancha Húmeda Biosphere Reserve (Central Spain). Aquatic

Conservation 9, 97-109.

Fornés, J., Rodríguez, J.A., Hernández, N., Llamas, M.R. 2000. Possible solutions to

avoid conflicts between water resources development and wetland conservation


130

in the "La Mancha Húmeda" Biosphere Reserve (Spain) Physics and Chemitry

of the Earth part B: Hydrology, Oceans and Atmosphere 25, 623-627.

Foulquier, A., Volat, B., Neyra, M., Bornette, G., Montuelle, B. 2013. Long-term

impact of hydrological regime on structure and functions of microbial

communities in riverine wetland sediments. FEMS Microbiology Ecology 85,

211-26.

Golterman, H.L., de Graaf Bierbrauwer-Würtz, I.M. 1992. Colorimetric determination

of sulphate in freshwater with a chromate reagent. Hydrobiologia 228, 111–115.

Gómez, J.M. 1987. Mortandad de aves en la Laguna Salada: incidencia en la población

de malvasías. Oxyura 1, 15-20.

[ISO] International Organization for Standardization. 2002. ISO6579:2002.

Microbiology of food and animal feeding stuffs: Horizontal method for the

detection of Salmonella sp. Geneva, Switzerland: ISO.

Johnson, T.J., Wannemuehler, Y., Johnson, S.J., Stell, A.L., Doetkott, C., Johnson, J.R.,

Kim, K.S., Spanjaard, L., Nolan, L.K. 2008. Comparison of extraintestinal

pathogenic Escherichia coli strains from human and avian sources reveals a

mixed subset representing potential zoonotic pathogens. Applied and

Environmental Microbioloy 74, 7043–7050.

Jouanneaua, S., Recoulesb, L., Duranda, M.J., Boukabacheb, A., Picotb, V., Primaultc,

Y., Lakeld, A., Sengeline, M., Barillonf, B., Thouanda, G. 2014. Methods for

assessing biochemical oxygen demand (BOD): a review. Water Research 49, 62-

82.

Lan Chun, C., Ochsner, U., Byappanahalli, M.N., Whitman, R.L., Tepp, W.H., Lin, G.,

Johnson, E.A., Peller, J., Sadowsky, M.J. 2013. Association of toxin-producing

Capítulo 3

131

Clostridium botulinum with the macroalga Cladophora in the Great Lakes.

Environmental Science and Technology 47, 2587-2594.

León-Quinto, T., De la Vega, A., Lozano, A., Pastor, S. 2004. Summer mortality of

waterbirds in a Mediterranean wetland. Waterbirds 27, 46-53.

Markman, S., Leitner, S., Catchpole, C., Barnsley, S., Müller, C.T., Pascoe, D.,

Buchanan, K.L. 2008. Pollutants increase song complexity and the volume of the

brain area HVC in a songbird. PLoS ONE 3, e1674.

doi:10.1371/journal.pone.0001674.

Martínez-Santos, P., De Stefano, L., Llamas, M.R., Martínez-Alfaro, P.E. 2008.

Wetland restoration in the Mancha occidental aquifer. Spain: A critical

perspective on water, agricultural, and environmental policies. Restoration

Ecology 16, 511-521.

Mason, C.F. 2002. Biology of freshwater pollution, 4th

ed. Pearson Education Limited,

Harlow, UK.


2000. Algal toxins—Initiators of avian botulism? Environmental Toxicology 15,

558-67.



Navarro, V., García, B., Sánchez, D., Asensio, L. 2011. An evaluation of the application

of treated sewage effluents in Las Tablas de Daimiel National Park. Central

Spain. Journal of Hydrology 401, 53-64.

Nol, P., Rocke, T.E., Gross, K., Yuill, T.M. 2004. Prevalence of neurotoxic Clostridium

botulinum type C in the gastrointestinal tracts of tilapia (Oreochromis

mossambicus) in the Salton Sea. Journal of Wildlife Diseases 40, 414–419.


132

Okafor, N. 2011. Pollution of aquatic systems: Pollution through eutrophication, fecal

materials, and oil spills. In Environmental Microbiology of Aquatic and Waste

Systems, Springer, Netherlands. p 151-183

Ortiz, N.E., Smith, G.R. 1994. Landfill sites, botulism and gulls. Epidemiological

Infection 112, 385–391.

Ramos, R., Cerdà-Cuéllar, M., Ramírez, F., Jover, L., Ruiz, X. 2010. Influence of refuse

sites on the prevalence of Campylobacter spp. and Salmonella serovars in

seagulls. Applied and Environmental Microbiology 76, 3052–3056.

Rocke, T.E., Euliss, N.H. Jr., Samuel, M.D. 1999. Environmental characteristics

associated with the occurrence of avian botulism in wetlands of a Northern

California refuge. Journal of Wildlife Management 63, 358-368.



1249-1260.

Rocke, T.E. 2006. The global importance of avian botulism. In Boere GC, Galbraith

CA, Stroud DA (eds), Waterbirds around the world. The Stationery Office,

Edinburgh, UK. p 422-426

Sánchez, D. 2013. Ph.D. thesis. University of Castilla la Mancha, Ciudad Real, Spain





Skanavis, C., Yanko, W.A. 2001. Clostridium perfringens as a potential indicator for

the presence of sewage solids in marine sediments. Marine Pollution Bulletin 42,

31-35.

Capítulo 3

133



van Asten, A.J., van der Wiel, C.W., Nikolaou, G., Houwers, D.J., Gröne, A. 2009. A

multiplex PCR for toxin typing of Clostridium perfringens isolates. Veterinary


Vidal, D., Anza, I., Taggart, M.A., Pérez-Ramírez, E., Crespo, E., Höfle, U., Mateo, R.

2013. Environmental factors influencing the prevalence of Clostridium

botulinum type C in non-permanent Mediterranean wetlands. Applied and




waterbirds and sediment samples: comparison with other PCR techniques.


Vidal, D., Taggart, M.A., Höfle, U., González, R., Cifuentes, A., Sánchez-Hernández,

L., Barcenilla, J., Jiménez, B., Green, A.J., Mateo, R. 2009. Análisis del riesgo

de intoxicación por botulismo en malvasía cabeciblanca y otras especies de aves

acuáticas en las Tablas de Daimiel y humedales cercanos [Risk analysis of

botulism poisoning in whiteheaded duck and other species of waterfowl in the

Tablas of Daimiel and nearby wetlands]. In: Proyectos de Investigación en

Parques Nacionales: 2005–2008. Ramírez, L., Asensio, B. (eds). Ministerio de

Medio Ambiente, Madrid, Spain. p 229–247

Wobeser, G., Marsden, S., MacFarlane, R.J. 1987. Occurrence of toxigenic Clostridium

botulinum type C in the soil of wetland in Saskatchewan. Journal of Wildlife

Diseases 23, 67-76.


134


33, 181–186.








3120-3127.

135

CAPÍTULO 4

Nueva perspectiva en la epidemiología de los brotes de

botulismo aviar: las moscas necrófacas como vectores de C.

botulinum tipo C/D

Moscas calífora (verde) y común sobre el cadaver de una garceta. Fotografía de Rafael Mateo

Anza, I.,

Vidal, D., Mateo, R. 2014. New insight in the epidemiology of avian botulism

outbreaks: necrophagous flies as vectors of Clostridium botulinum type C/D.

Environmental and Microbiology Reports (ahead of print) doi: 10.1111/1758-

2229.12197.


136

Nueva perspectiva en la epidemiología de los brotes de botulismo aviar: las moscas

necrófacas como vectores de C. botulinum tipo C/D.

RESUMEN

Los brotes de botulismo aviar se propagan por el ciclo de ”larva de mosca-cadáver”, por

el cual, Clostridium botulinum y las moscas necrófagas interactúan para asegurar su

reproducción en una relación mutualista donde las larvas de mosca portadoras de

esporas/toxina son la pieza clave. En este estudio investigamos la hipotesis de que las

moscas adultas puedan también tener un papel significativo en los brotes de botulismo

llevando microorganismos de C. botulinum entre cadáveres. Para comprobarlo,

relizamos un experimento de campo en el que pusimos cadáveres de aves libres de C.

botulinum tipo C/D en recipientes sólo accesibles a invertebrados voladores en

humedales con brote de botulismo y en zonas control. Además, realizamos

experimentos laboratoriales para evaluar si las moscas necrófagas (calíforas) pueden

transportar C. botulinum tipo C/D y por cuanto tiempo. Como resultado, el 27.5% de los

cadáveres previamente negativos colocados en humedales con brote desarrollaron larvas

portadoras del clostridio. Además, en el laboratorio, las moscas calíforas fueron capaces

de transferir C. botulinum entre dos puntos y lo excretaron hasta 24 h después de

alimentarse de él. Nuestros resultados confirman que que las moscas necrófagas juegan

un papel en la propagación de los brotes de botulismo con implicaciones en su

epidemiología.

Capítulo 4

137

New insight in the epidemiology of avian botulism outbreaks: necrophagous flies as

vectors of Clostridium botulinum type C/D

ABSTRACT

Avian botulism outbreaks spread through the “bird carcass-maggot” cycle, in which

Clostridium botulinum and blowflies interact to ensure their reproduction in a

mutualistic relationship where neurotoxin/spore-bearing maggot is one of the keystones.

Here, we investigated the hypothesis that adult blowflies may also play a significant

role in botulism outbreaks by carrying C. botulinum cells between carcasses. We carried

out a field experiment placing bird carcasses free of C. botulinum type C/D in

containers only accessible to necrophagous flying insects in wetlands where avian

botulism outbreaks were occurring and in control sites. Additionally, we performed

laboratory trials to evaluate if blowflies may carry C. botulinum type C/D and for how

long. Maggots bearing C. botulinum type C/D developed in 27.5% of carcasses placed

in wetlands during botulism outbreaks. Calliphoridae flies in laboratory trials were able

to transfer C. botulinum between two points and excreted it in their spots for up to 24 h

after an infective feeding. Our results confirm that adult necrophagous flies play a role

in the spreading of botulism outbreaks which have implications in the epidemiology of

this disease.


138

1. Introduction

Avian botulism is an intoxication caused by the botulinum neurotoxin (BoNT),

which causes a severe flaccid paralysis of the muscles and death in birds and mammals

(Rocke and Bollinger, 2008; Defilippo et al., 2013). This neurotoxin is secreted by

Clostridium botulinum, a strictly anaerobic and spore-forming Gram positive bacterium.

Several types of BoNT serotypes exist; type C/D is the most common in avian botulism

outbreaks in Europe (Woudstra et al., 2012; Anza et al., 2014a). In a global basis,

botulism is one of the most important diseases for waterbirds (Rocke, 2006), and it is an

emerging serious disease in poultry (Lindberg et al., 2010). Birds get intoxicated after

ingesting the toxin along with their prey (invertebrates or fishes), and it has also been

suggested that spores may germinate in their digestive tract producing a toxico-infection

(Rocke, 2006; Lindberg et al., 2010).

Outbreaks in waterbirds occur mostly between summer and autumn, when high

temperatures along with increasing biomass and anaerobic conditions in wetlands

allows the growth of C. botulinum in the environment (Rocke and Bollinger, 2008;

Anza et al., 2014b). In wetlands from south-central Spain, outbreaks occur almost every

year and usually last one to two months between June and October. Mortality rate vary

between years and locations, and it has been positively correlated with temperature

(Vidal et al., 2013). These outbreaks propagate and become self-perpetuating by a

process known as the carcass-maggot cycle of avian botulism, during which toxin-

loaded maggots amplify the number of intoxicated birds: first, a bird with C. botulinum

in its digestive tract dies and its carcass provides an anaerobic and protein-rich

environment where the microorganism grows and produces toxin; simultaneously,

maggots develop in the carcass accumulating the toxin (which does not affect

Capítulo 4

139

invertebrates) and finally, healthy birds eat the toxin-loaded maggots, die and generate

new substrate for the growth of C. botulinum and toxinogenesis. This cycle continues

until conditions become unsuitable (i.e. decreasing temperatures, carcass removal, bird

disaggregation) for bacteria and/or larval growth (Wobeser, 1997; Soos and Wobeser,

2006). Percentages of carcasses that develop toxic maggots during botulism outbreaks

vary between studies from 85–90% (Duncan and Jensen, 1976) to 12-74% (Soos and

Wobeser, 2006). Environmental factors, such as temperatures and fly activity, may

contribute to this variance. Although the highest concentrations of toxin have been

described in carcass-maggots, other types of invertebrates, especially scavenger snails

and beetles, may also carry spores and toxin, and serve as secondary sources of

bacterium and/or its toxin for birds (Duncan and Jensen, 1976; Vidal et al., 2013; Anza

et al., 2014b). Avian botulism outbreaks are difficult to prevent because C. botulinum

spores are ubiquitous in wetlands, and environmental conditions that lead to spore

germination and toxin production are diverse, unclear and complex to manage (Rocke

and Bollinger, 2008). This is why outbreaks control relies on prompt detection and

removal of bird carcasses, so as to stop the carcass-maggot cycle (Evelsizer et al.,

2010b).

Flies are mechanical vectors of a variety of diseases and play an important role

in spreading them. For example, Turrell and Knudson (1987) demonstrated that stable

flies can mechanically carry Bacillus anthracis from anthrax-infected guinea pigs to

healthy ones, and Cohen et al. (1991) observed that the control of flies in a military base

decreased the incidence of shigellosis by 85%. Different pathogens, such as B.

anthracis, Escherichia coli, Salmonella spp. or Staphylococcus spp., have been isolated

from flies external surfaces and their spots (vomits and feces) (Nazni et al., 2005;

Fasanella et al., 2010; Lindsay et al., 2012). Clostridium botulinum type C or C/D cells


140

and toxin have already been detected in adult Calliphoridae flies and Dermestidae

beetles caught near bird carcasses during botulism outbreaks (Duncan and Jensen 1976;

Vidal et al., 2013). Blow and flesh flies (families Calliphoridae and Sarcophagidae)

feed and oviposit on carrion (Norris, 1965) and the role of their maggots in the

spreading of botulism outbreaks by the carcass-maggot cycle is well documented

(Hubálek and Halouzka, 1991), but to our knowledge there are no studies focused on

the potential role of adult flies as vectors of C. botulinum type C/D during the

propagation of avian botulism outbreaks. Flies feed and lay eggs over different bird

carcasses, so we hypothesize that, during this process, they may transfer C. botulinum

cells and increase the number of carcasses with toxin loaded maggots, therefore

spreading the outbreaks. Moreover, we propose that this relationship between

necrophagous flies and C. botulinum may be studied as a mutualism, because both

species ensure the substrate for their reproduction (bird carcasses) with their interaction.

We tested this hypothesis by placing carcasses free of C. botulinum type C/D in

containers only accessible to flying insects in wetlands where an outbreak was taking

place, so as to determine if the flies trapped in them and the maggots born from their

eggs carried the pathogen. We also performed laboratory experiments to determine

under controlled conditions if Calliphoridae flies can transport viable C. botulinum type

C/D cells and for how long can eliminate them in their spots.

http://onlinelibrary.wiley.com/doi/10.1111/mec.12183/full#mec12183-bib-0025

Capítulo 4

141


2.1 Field experiment: transport of C. botulinum type C/D between carcasses by

necrophagous insects

The study was carried out in different wetlands and urban areas of the province

of Ciudad Real, in south central Spain, for two consecutive years, 2012 and 2013.

Eighty three bird carcasses free of C. botulinum type C/D inserted in containers only

accessible to flying necrophagous invertebrates (Fig. 1A) were hung on vegetation 150-

200 cm above the ground until maggots infestation was observed (between 5 and 14

days). Fifty four were set in botulism endemic wetlands (43 during outbreak periods and

11 two months before an outbreak) and 29 in control sites (Table 1). Maggots developed

in 78 carcasses and were analyzed in pools of 3 to 8 individuals from each carcass for

the presence of C. botulinum type C/D by real time PCR after culture enrichment

(Sánchez-Hernandez et al., 2008; Vidal et al., 2011). This assay amplifies genes

encoding both, type C and type C/D mosaic toxins, but as in the study area type C/D is

predominant we assumed that we were detecting the mosaic type (Vidal et al., 2013;

Anza et al., 2014). Eighty one individual necrophagous flies (43 from outbreak and 38

from control and pre-outbreak sites) and 55 beetles (37 from outbreak and 18 from

control and pre-outbreak sites) randomly selected from 79 containers were analyzed

with the same PCR assay (Table 1).


142

Fig. 1. A. Design of the carrion-fly traps used in the field experiment consisting of a 5 l water

plastic bottle with two holes in the bottom that allowed the pass of carrion flies attracted by the

odor of a bird carcass used as bait and where maggots develop. B. Design of the odor-baited fly

traps used for capturing flies for the laboratory experiments: a. holes, b. pork liver on an agar

plate base, c. opaque plastic pot, d. funnel, e. plastic bag, f. string.

2.2 Laboratory experiments

2.2.1 Transport of C. botulinum by Calliphoridae flies

Sixty Calliphoridae flies captured in urban sites with odor-baited traps (Fig. 1B)

were maintained inside two plastic framed cages (30 flies each) of 50 × 50 cm covered

on all sides by mosquito net (Fig. 2). In one cage, 20 sterile cotton-wool swabs

(CLASSIQSwabsTM

Copan) saturated in a solution of cooked meat broth and glucose

(BD BBL cooked meat medium with glucose, BD) were pierced in one of the walls, and

another 10 swabs saturated in the same solution but containing 25 spores/µl of C.

botulinum type C/D were pierced in the opposite wall. The C. botulinum type C/D strain

used was isolated from the gastric content of a black-headed gull (Chroicocephalus

Capítulo 4

143

ridibundus) collected in the summer of 2005 in the province of Ciudad Real (internal

reference IREC-B136) and confirmed as C. botulinum type C/D by PCR (Vidal et al.,

2013). The second cage was placed beside and used as control with 20 swabs saturated

in the same solution of cooked meat broth pierced between two opposite walls. After 48

h flies were frozen so as to kill them. All flies and swabs were analyzed with the same

real-time PCR protocol used for the field experiment (Sánchez-Hernandez et al., 2008;

Vidal et al., 2011).

Fig. 2. Design of the cage used for the C. botulinum transport experiment. Twenty sterile

cotton-wool swabs saturated in a solution of cooked meat broth and glucose were placed in one

wall and 10 swabs saturated in the same solution but containing 25 spores/µl of C. botulinum

type C/D were placed in the opposite wall.

2.2.2 Time of excretion of C. botulinum type C/D by Calliphoridae flies

Twelve Calliphoridae flies were captured in urban sites with odour-baited traps

(Fig. 1A), and their spots were tested by real-time PCR to confirm that they were

negative to the pathogen. Then, they were placed in individual Petri dishes and fed with


144

a solution of cooked meat broth and glucose containing 25 spores/µl of the same strain

of C. botulinum type C/D used in the previous experiment (Fig. 3). After, they were

transferred to new sterile Petri dishes at 3, 6, 9, 12, 24 and 27 h, and the spots (vomitus

and faeces) that remained in the dishes were collected with sterile cotton swabs and

tested by real-time PCR (same assay as in previous experiments) for the presence of C.

botulinum type C/D. In 7 occasions, there were no spots in the Petri dishes, so the swabs

were passed over their surface.

Fig. 3. Calliphoridae fly feeding on a C. botulinum type C/D infective swab prior to excretion

experiment. Fly spots can be observed on the surface of the Petri dish.

3. Results and discussion

3.1 Transport of C. botulinum type C/D between carcasses by necrophagous insects in

the field

Based on the Fisher´s test, there were significant differences (P<0.01) in the

frequency of detection of C. botulinum type C/D in maggots (27.5%) and in adult flies

Capítulo 4

145

(18.6%) collected in outbreak sites compared with the frequency observed in control

and pre-outbreak sites where the pathogen was absent (Table 1). The highest prevalence

was detected on Sarcophagidae flies (27%), followed by Calliphoridae flies (19%),

Muscidae flies (9%) and Dermestidae beetles (8.1%), although there were no significant

differences between families (Table 2). In many wetlands, botulism is an endemic

disease (birds intoxicate at a low rate) with periodic epidemics (birds intoxicate at a

greater rate) when large outbreaks occur. The most critical factor for the spreading of

large avian botulism outbreaks is the density of carcasses that contain C. botulinum

spores which will germinate and produce toxin (Rocke and Bollinger, 2008; Evelsizer et

al., 2010a). In this sense, Wobeser (1997) stated that the secondary poisoning is the

major factor causing large outbreaks and proposed that these occur when the average

number of birds dying of secondary poisoning attributable to a single carcass is >1. This

further depends on four factors: “the probability of carcasses developing maggots”, “the

probability of maggots accumulating toxin”, “the contact rate between susceptible birds

and toxic material” and “the proportion of contacts resulting in intoxication and death”

(Soos and Wobeser, 2006). The first factor largely depends on the activity of blowflies,

and the second factor may also be influenced by flies because, as we have shown, they

may act as vectors of C. botulinum type C/D cells and contribute to colonize with it up

to 27.5% of previously uncontaminated carcasses. Taking into account that the presence

of C. botulinum type C/D in the environment in the study area is generally low (6% in

sediment samples, Vidal et al., 2013), the contribution of flies to the spreading of the

outbreaks can be substantial. In this sense, Reed and Rocke (1992) found high levels of

toxin in 16% of maggots developing on previously healthy euthanized bird carcasses

and in 10% of maggots developing on botulism-intoxicated bird carcasses placed in

adjacent pools; they suggested that the euthanized bird carcasses were already infected


146

with spores, but another feasible hypothesis is that flying necrophagous invertebrates

transported them, as observed here. Further support to our findings is that several

studies have shown that adult flies are vectors of a variety of pathogens (Nazni et al.,

2005; Fasanella et al., 2010; Lindsay et al., 2012). The absence of the pathogen in our

controls ruled out that cross contamination occurred from our traps themselves.

3.2 Transport of C. botulinum type C/D by Calliphoridae flies under controlled

conditions

After 48 h, 3 of the 20 (15%) previously sterile cotton swabs and 1 of the 30

flies (3.3%) from the experimental cage tested positive to C. botulinum type C/D by real

time PCR, while all the samples from the control cage, swabs and flies, were negative.

This experiment performed under controlled conditions definitely shows that

Calliphoridae flies can transport C. botulinum cells and supports the field findings.

147

Table 1. Samples collected during the field experiment and analyzed for the presence of C.botulinum type C/D.

Site status Site1 Date

Carcasses

(parasitized/total)

Positive maggot pools/total no

of parasitized carcasses (%)2

Positive flies/total no

of flies (%)3

Positive beetles/total no

of beetles (%)3

Control Urban area Jul-Aug 2012 3/5 0/3 0/0 0/0

Urban area Sep 2013 10/10 0/10 0/0 0/5

Tablas Daimiel Jun-Jul 2013 14/14 0/14 0/19 0/9

All 27/29 0/27 0/19 0/14

Pre-outbreak Navaseca May 2013 11/11 0/11 0/19 0/4

Control + pre-outbreak 38/40 0/38 0/38 0/18

Outbreak Navaseca Jul-Aug 2012 22/24 4/22 (18.2) 4/27 (14.8) 1/8 (12.5)

Navaseca Aug 2013 10/10 3/10 (30) 1/8 (12.5) 0/11

Pozuelo Jul-Aug 2013 8/9 4/8 (50) 3/8 (37.5) 2/18 (11.1)

All 40/43 11/40 (27.5)*+

8/43 (18.6)+ 3/37 (8.1)

1 Tablas Daimiel, Navaseca and Pozuelo are wetland areas.

2 Pool of maggots contain 3 to 8 individuals.

3 Flies and beetles were analyzed individually, they can proceed from the same trap.

*Prevalence during “outbreak” significantly higher than in its correspondent “control” samples (P< 0.01).

+ Prevalence during “outbreak” significantly higher than in its correspondent “control + pre-outbreak” samples (P< 0.01).


148

Table 2. Presence of C. botulinum type C/D in individuals of different families of necrophagous

flies and beetles in sites where an avian botulism outbreak was taking place and in sites with no

outbreak.

Non outbreak sites Outbreak sites

Family of fly

or beetle

No. of

individuals

No. of

positive

individuals

% positive

individuals*

No. of

individuals

No. of

positive

individuals

% positive

individuals

*

Calliphoridae 13 0 0 21 4 19

Muscidae 14 0 0 11 1 9.1

Sarcophagidae 11 0 0 11 3 27

Dermestidae 18 0 0 37 3 8.1

*Percentages of detection of C. botulinum type C/D were not significantly different between families or

sites

3.3 Excretion of C. botulinum type C/D by Calliphoridae flies

Eleven of the 12 flies excreted C. botulinum type C/D at least once between 3 and

24 hours post-infective feeding. After 3 hours, C. botulinum could be detected in the

spots of 7 of the 12 flies (58%) and this number decreased every 3 h; after 24 h, the

pathogen was only detected in the spots of one fly (8%), and after 27 h it was absent

(Fig.4). These results demonstrate that flies can excrete C. botulinum type C/D cells

during the following 24 h after a single infective exposure. Moreover, C. botulinum was

absent from the surface of the 7 Petri dishes where the exposed flies landed but did not

deposit spots, which suggests that flies transmit the pathogen fecal-orally rather than by

direct contamination with spores present on their body surfaces. These results are in

agreement with Fasanella et al. (2010) who recovered anthrax organisms from fly spots

mainly 2 to 12 h after an infective feeding, with a peak at 10 h, but no longer than 24 h.

Calliphoridae flies can live up to 5 weeks so they can act as vectors for a substantial

period of time. In addition, some species usually move up to 6 km and sometimes up to

Capítulo 4

149

32 km (Cragg and Hobart, 1955; Braack and De Vos, 1990), so its role as mechanical

vectors of C. botulinum type C/D spores should not be underestimated.

Fig.4. Percentage of flies (N=12) that excreted C. botulinum type C/D after an infective feeding.

4. Perspectives

These results highlight the importance of prompt removal and proper disposal, by

burying or burning, of bird carcasses so as to avoid the propagation of the outbreaks by

flies. Studies about the efficiency of fly-control to prevent the spreading of botulism

outbreaks would be necessary to determine the real importance of flies in the

epidemiology of the outbreaks. For example, it has been demonstrated that fly-control

can reduce the incidence of human diseases, such as shigellosis, by 40-85% (Cohen et al,

1991; Farag et al, 2013) and the prevalence of Campylobacter spp.–positive poultry


150

flocks by 77% (Bahrndorff et al, 2013). New experiments are needed for understanding

the real epidemiological potential of Calliphoridae as it would be crucial to know if flies

only act as mechanical vectors of C. botulinum spores or if they are also bioenhancers of

transmission following spore germination and replication in their intestinal tract as it has

been demonstrated for other pathogens (Fasanella et al., 2010). Finally, from the

ecological point of view, it is interesting to point out that the relationship between C.

botulinum type C/D and blowflies has characteristics of a mutualism because both

organisms take advantage of it (Landry, 2012; Herre et al., 1999). Carrion in nature is an

unexpected, ephemeral and patchy nutrient-rich resource for a variety of living

organisms. These ephemeral patches support high levels of diversity where direct and

indirect interactions occur between vertebrates, insect species and microbes that compete

for the same resource (Barton et al., 2013). In this framework, C. botulinum type C/D is a

poor competitor and its growth is limited by other bacteria in sediments (Sandler et al.,

1998), so in turn, it produces a lethal toxin that kills vertebrates generating carcasses

where it multiplies more easily. Meanwhile, maggots also grow in those carcasses,

accumulate the botulinum toxin -without suffering its effects- and carry the toxin and C.

botulinum cells to new healthy birds, spreading the outbreaks and creating new organic

resources for both, C. botulinum and flies. Moreover, flies can act as vectors of C.

botulinum type C/D cells, thus increasing the probabilities of toxin production in the

carcasses where they lay eggs. Without flies, the chances for C. botulinum type C/D to

kill/colonize new birds (via maggots) or carcasses (via flies) in nature would be reduced

or non-existent and, maybe, some fly phenotypes are dependent upon this relationship.

Capítulo 4

151

Acknowledgments

We thank the cooperation of staff from the Tablas of Daimiel National Park and

of the environmental agents from Castilla-La Mancha (JCCM). We also thank Miguel

Carles-Tolrá for helping with the identification of the fly families. This study was

supported by the Spanish Ministry of Environment (grants OAPN 099/2003 and OAPN

035/2009). Ibone Anza was supported by a JAE PRE grant from CSIC.

References

Anza, I., Skarin, H., Vidal, D., Lindberg, A., Båverud, V., Mateo, R. 2014a. The same




Mateo, R. 2014b. Eutrophication and bacterial pathogens as risk factors for avian

botulism outbreaks in wetlands receiving effluents from urban wastewater

treatment plants. Applied and Environmental Microbiology 80, 4251-4259.

Bahrndorff, S., Rangstrup-Christensen, L., Nordentoft, S., Hald, B. 2013. Foodborne

Disease Prevention and Broiler Chickens with Reduced Campylobacter Infection.

Emerging Infectious Diseases 19, 425-430.

Barton, P.S., Cunningham, S.A., Lindenmayer, D.B., Manning, A.D. 2013. The role of

carrion in maintaining biodiversity and ecological processes in terrestrial

ecosystems. Oecologia 171, 761-772.

Braack, L.E., De Vos, V. 1990. Feeding habits and flight range of blow-flies

(Chrysomyia spp.) in relation to anthrax transmission in the Kruger National Park,

South Africa. Onderstepoort Journal of Veterinary Research 57, 141-142.

http://www.ncbi.nlm.nih.gov/pubmed?term=Anza%20I%5BAuthor%5D&cauthor=true&cauthor_uid=24418766

http://www.ncbi.nlm.nih.gov/pubmed?term=Skarin%20H%5BAuthor%5D&cauthor=true&cauthor_uid=24418766

http://www.ncbi.nlm.nih.gov/pubmed?term=Vidal%20D%5BAuthor%5D&cauthor=true&cauthor_uid=24418766



http://www.ncbi.nlm.nih.gov/pubmed?term=Mateo%20R%5BAuthor%5D&cauthor=true&cauthor_uid=24418766

http://www.ncbi.nlm.nih.gov/pubmed?term=Barton%20PS%5BAuthor%5D&cauthor=true&cauthor_uid=23007807

http://www.ncbi.nlm.nih.gov/pubmed?term=Cunningham%20SA%5BAuthor%5D&cauthor=true&cauthor_uid=23007807

http://www.ncbi.nlm.nih.gov/pubmed?term=Lindenmayer%20DB%5BAuthor%5D&cauthor=true&cauthor_uid=23007807

http://www.ncbi.nlm.nih.gov/pubmed?term=Manning%20AD%5BAuthor%5D&cauthor=true&cauthor_uid=23007807


152

Cohen, D., Green, M., Block, C., Slepon, R., Ambar, R., Wasserman, S.S., Levine, M.M.

1991. Reduction of transmission of shigellosis by control of houseflies (Musca

domestica). Lancet 337, 993–997.

Cragg, J.B., Hobart, J. 1955. A study of a field population of the blowflies Lucilia caesar

(L.) and L. sericata (MG.). Annals of Applied Biology 43, 645-663.

Defilippo, F., Luppi, A., Maioli, G., Marzi, D., Fontana, M.C., Paoli, F., Bonilauri, P.,

Dottori, M., Merialdi, G. 2013. Outbreak of type C botulism in birds and

mammals in the Emilia Romagna region, northern Italy. Journal of Wildlife

Diseases 49, 1042-1046.


invertebrates in the epizootiology of avian botulism. Journal of Wildlife Diseases

12, 116–126.

Evelsizer, D.D., Bollinger, T.K., Dufour, K.W., Clark, R.G. 2010a. Survival of radio-

marked mallards in relation to management of avian botulism. Journal of Wildlife

Diseases 46, 864–877.

Evelsizer, D.D., Clark, R.G., Bollinger, T.K. 2010b. Relationships between local carcass

density and risk of mortality in molting mallards during avian botulism outbreaks.


Farag, T.H., Faruque, A.S., Wu, Y., Das, S.K., Hossain, A., Ahmed, S., Ahmed, D.,

Nasrin, D., Kotloff, K.L., Panchilangam, S., Nataro, J.P., Cohen, D., Blackwelder,

W.C., Levine, M.M. 2013. Housefly population density correlates with shigellosis

among children in Mirzapur, Bangladesh: a time series analysis. PLoS Negl Trop

Dis 7, e2280. doi:10.1371/journal.pntd.0002280.



Capítulo 4

153

Fasanella, A., Scasciamacchia, S., Garofolo, G., Giangaspero, A., Tarsitano, E., Adone,

R. 2010. Evaluation of the house fly Musca domestica as a mechanical vector for

an anthrax. PLoS ONE 5: e12219. doi:10.1371/journal.pone.0012219.

Herre, E.A., Knowlton, N., Mueller, U.G., Rehner, S.A. 1999. The evolution of

mutualisms: exploring the paths between conflict and cooperation. Trends in

Ecology and Evolution 14, 49-53.

Hubálek, Z., Halouzka, J. 1991. Persistence of Clostridium botulinum type C toxin in

blow fly (Calliphoridae) larvae as a possible cause of avian botulism in spring.


Landry, C. 2012. Mighty mutualisms: The nature of plant-pollinator interactions. Nature

Education Knowledge 3, 37.

Lindberg, A., Skarin, H., Knutsson, R., Blomqvist, G., Båverud, V. 2010. Real-time PCR

for Clostridium botulinum type C neurotoxin (BoNTC) gene, also covering a

chimeric C/D sequence-application on outbreaks of botulism in poultry.


Lindsay, S.W., Lindsay, T.C., Duprez, J., Hall, M.J.R., Kwambana, B.A., Jawara, M.,

Nurudeen, I.U., Sallah, N., Wyatt, N., D’Alessandro, U., Pinder, M., Antonio., M.

2012. Chrysomya putoria, a putative vector of diarrheal diseases. PLoS Neglected

Tropical Diseases 6, e1895. doi:10.1371/journal.pntd.0001895.

Nazni, W.A., Seleena, B., Lee, H.L., Jeffery, J.T., Rogayah, T.A., Sofian, M.A. 2005.

Bacteria fauna from the house fly, Musca domestica (L.). Tropical Biomedicine

22, 225-231.

Norris, K.R. 1965. The bionomics of blow flies. Annual Review of Entomology 10, 47–

68.




154



Rocke, T.E., Bollinger, T.K. 2008. Avian botulism. In Infectious diseases of wild birds.

Thomas, N.J., Hunter, D.B., Atkinson, C.T. (eds). Blackwell Publishing

Professional, Ames, Iowa, USA. p 377-416.

Rocke, T. E. 2006. The global importance of avian botulism. In Waterbirds around the

world. Boere, G.C., Galbraith, C.A., Stroud, D.A. (eds). The Stationery Office,


Sandler, R.J., Rocke, T.E., Yuill, T.M. 1998. The inhibition of Clostridium botulinum

type C by other bacteria in wetland sediments. Journal of Wildlife Diseases 34,

830-833.



products by real time versus capillary gel electrophoresis methods. European Food

Research and Technology 227, 495–502.


botulism outbreaks. Journal of Wildlife Management 70, 43–53.

Turell, M.J., Knudson, G.B. 1987. Mechanical transmission of Bacillus anthracis by

stable flies (Stomoxys calcitrans) and mosquitoes (Aedes aegypti and Aedes

taeniorhynchus). Infection and Immunity 55, 1859–1861.


reaction for the detection of toxigenic Clostridium botulinum type C1 in waterbird

and sediment samples: comparison with other PCR techniques. Journal of

Veterinary Diagnostic Investigation 23, 942–946.

http://www.ncbi.nlm.nih.gov/pubmed?term=Sandler%20RJ%5BAuthor%5D&cauthor=true&cauthor_uid=9813858

http://www.ncbi.nlm.nih.gov/pubmed?term=Rocke%20TE%5BAuthor%5D&cauthor=true&cauthor_uid=9813858

http://www.ncbi.nlm.nih.gov/pubmed?term=Yuill%20TM%5BAuthor%5D&cauthor=true&cauthor_uid=9813858


Capítulo 4

155



type C in non-permanent Mediterranean wetlands. Applied and Environental



33, 181–186.


Bäyon-Auboyer, M.H., Buffereau, J.P., De Medici, D., Fach, P. 2012. Neurotoxin

gene profiling of Clostridium botulinum types C and D native to different

countries within Europe. Applied and Environmental Microbiology 78, 3120-

3127.

156

CAPÍTULO 5

Diferencias en la susceptibilidad al botulismo y en la excreción

de C. botulinum tipo C/D entre especies de aves acuáticas

Fototrampeo en la laguna de Pozuelo de Calatrava, Ciudad Real. Fotografía de Ibone Anza

Anza, I., Vidal, D., Feliu, J., Crespo, E., Mateo, R. In preparation. Differences in

susceptibility to avian botulism and C. botulinum type C/D excretion between waterbird

species.

Capítulo 5

157

Diferencias en la susceptibilidad al botulismo y en la excreción de C. botulinum tipo

C/D entre especies de aves acuáticas

RESUMEN

El botulismo aviar mata miles de aves acuáticas todos los años incluyendo especies en

peligro. Las aves que portan y mueren con C. botulinum tipo C/D en su tracto

gastrointestinal son un factor clave para el inicio y propagación de los brotes. En este

estudio, estimamos la susceptibilidad al botulismo de 11 especies de aves acuáticas

comunes en humedales mediterráneos, analizando el número de aves muertas o enfermas

de cada especie en función del censo de individuos en riesgo en diferentes momentos

durante el periodo de brote. Además, analizamos la presencia de C. botulinum tipo C/D

en hisopos cloacales, muestras de heces e invertebrados acuáticos recogidos durante

periodos con brote y sin brote. Encontramos diferencias en la susceptibilidad al botulismo

entre especies, probablemente relacionados con el tipo de alimentación, y posiblemente

resistencia innata. También el uso temporal del humedal afectó al número de aves

muertas de ciertas especies. La presencia de la especie invasora de caracol acuático,

Physella acuta, podría ser un importante conductor en la epidemiología de los brotes, ya

que un alto porcentaje de ellos (30%) portan el patógeno durante los brotes. La excreción

de C. botulinum por aves acuáticas parece estar relacionado con la prevalencia del

patógeno en el medio y la fisiología digestiva de cada especie. Así, nuestros resultados

muestran que especies herbívoras como las fochas (Fulica atra) y los ánades frisos (Anas

strepera) pueden tener un papel más importante en la dispersión del botulismo porque

mantienen y excretan el patógeno durante más tiempo. La globalmente amenazada

malvasía cabeciblanca (Oxyura leucocephala) mostró una tasa de mortalidad durante los


158

brotes estudiados de entre el 7 y el 17% del número máximo de animales censados, lo que

hace del botulismo un factor de riesgo importante para la conservación de la especie.

Capítulo 5

159

Differences in susceptibility to avian botulism and C. botulinum type C/D excretion

between waterbird species.

ABSTRACT

Avian botulism kills thousands of waterbirds every year including endangered species.

Birds that carry and die with C. botulinum type C/D in their gastrointestinal tract are a

key factor for initiating and spreading these outbreaks. We estimated the susceptibility to

botulism of 11 common waterbird species in Mediterranean wetlands by analyzing the

number of death and sick birds of each species in relation to the number of life

individuals counted. Additionally, we analyzed the presence of C. botulinum type C/D in

waterbird cloacal swabs, fecal samples and aquatic invertebrates collected during

outbreak and non-outbreak periods. We found differences among species in their

susceptibility to botulism, probably related with feeding habits and, possibly, genetic

resilience. Also the temporal wetland use patterns influenced the number of dead birds of

certain species. The invasive water snails, as Physella acuta, may be an important driver

in the botulism epidemiology, because 30% of samples tested positive to the BoNT gene

during outbreaks. The excretion of C. botulinum by waterbirds seemed to be related with

the prevalence of the pathogen in the environment and the digestive physiology of the

species. Our results show the possibility that some herbivorous waterbirds like coots

(Fulica atra) and gadwalls (Anas strepera) may have a more significant role in the

dispersion of botulism than others, because they retain the pathogen for longer periods.

The globally endangered white-headed duck (Oxyura leucocephala) showed mortality

rates in the studied outbreaks of 7 and 17% of the maximum census, which highlights

botulism as an important risk factor for the conservation of the species.


160

1. Introduction

Avian botulism is an intoxication characterized by a severe flaccid paralysis of the

muscles and final death by respiratory failure caused by the botulinum neurotoxins

(BoNT) produced by Clostridium botulinum (Rocke and Friend, 1999). Botulism

outbreaks in freshwater waterbirds are generally caused by C. botulinum type C (Rocke,

2006) though, in recent years, it has been shown that in Europe a more lethal mosaic type

C/D is widely spread (Woudstra et al., 2012; Anza et al., 2014a). In the Great Lakes of

North America, type E also causes botulism outbreaks in fish eating birds (Shutt et al.,

2014). Outbreaks mostly occur between summer and autumn, when high temperatures

allow the multiplication and toxigenesis of C. botulinum on bird carcasses. Then, an

exponential process known as “the carcass maggot-cycle” triggers the outbreak when

healthy birds feed on toxin (and bacteria)-loaded maggots from each carcass and die

(Reed and Rocke, 1992; Wobeser, 1997; Rocke, 2006). Factors such as pH between 7.5

and 9, low redox potential, increasing temperature, decreasing turbidity, low salinity,

eutrophication, high invertebrate density and bird abundance has also been associated

with botulism risk in wetlands (Rocke and Samuel, 1999; Murray and Hamilton, 2010;

Anza et al., 2014b). Mortality varies between years and places, from hundreds to

thousands of birds may die in a single outbreak (Friend et al., 2001; Vidal et al., 2013).

Botulism stands as one of major diseases of waterbirds because it causes high

losses, affects a broad spectrum of species, occurs annually and seems to be increasing its

geographic area (Friend et al., 2001). Populations of species that are numerous and

geographically widespread may cope with sporadic and sudden high losses (i.e. mallard

Anas platyrhynchos or coots Fulica atra), while populations of endangered or local

Capítulo 5

161

species are more vulnerable and a single botulism outbreak may have catastrophic

consequences for their viability (Rocke, 2006). For example, in 1996 botulism killed

almost 15-20% of the western metapopulation of American white pelican (Pelecanus

erythrorhynchos) (Rocke et al., 2005). Later on, it killed a relevant number of individuals

of two critically endangered species, the black-faced spoonbill (Platalea minor) in

Taiwan and the Laysan duck (Anas laysanensis) in Hawaii (Chou, 2008; Work et al.,

2010). Botulism has also been linked with the local extintion of the breeding population

of great black-backed gulls (Larus marinus) in eastern Lake Ontario (Shutt et al., 2014)

and with declines in the population of pintail ducks (Anas acuta) in the United States

(Friend et al., 2001). In Spain, two threatened species such as the white-headed duck

(Oxyura leucocephala) and the ferruginous duck (Aythya nyroca) regularly die during

botulism outbreaks (Vidal et al., 2013). In addition, white-headed duck in the study area

usually breeds in highly eutrophic wetlands receiving the effluent of wastewater

treatment plants, where the risk of botulism outbreaks has been found to be elevated

(Vidal et al., 2013; Anza et al., 2014b).

Susceptibility to botulism intoxication differs between bird species and only

vultures seem to be resistant (Rocke and Friend, 1999). Foraging behavior is probably a

significant factor influencing this susceptibility, because dabbling waterfowl and

shorebird species that feed near the surface seem to be more prone to intoxication than

diving ducks or probers (Rocke and Friend, 1999; Adams et al., 2003; Vidal et al., 2013).

However, the susceptibility to botulism of multiple waterbird species has never been

quantitatively evaluated taking into account the census of individuals at risk during the

outbreaks.

Host-pathogen relationships are determinant to understand the ecology of

diseases. In the case of botulism, the role of carrier birds is unclear, as it is not known for


162

how long a bird may maintain spores/cells in its gastrointestinal track or whether the

disease is always an intoxication, or if toxicoinfection could exist when the toxin is

produced in the gastrointestinal track. For instance, Reed and Rocke (1992) reported that

21 of 40 healthy mallards (Anas platyrhynchos) from wetlands where botulism outbreaks

have occurred carried C. botulinum spores in their intestinal tract. We also suggested that

waterbirds can spread this bacterium with their feces (Anza et al, 2014b). In fact, the

similarity of the same strains of C. botulinum type C/D in both extremes of the Palearctic

migratory flyway (Sweden and Spain) may respond to this role of waterbirds as carriers

of this bacterium (Anza et al., 2014a).

With this study, we aim to (1) estimate differences in the susceptibility to

botulism of the most common waterbirds inhabiting wetlands of Central Spain, including

the globally endangered white-headed duck, (2) to find sources of the bacterium (aquatic

invertebrates) that could explain differences in the susceptibility of the waterbirds species

related to diet, and (3) to investigate the role of healthy and intoxicated birds as dispersers

of C. botulinum type C/D through fecal excretion.


2.1 Study area

The study area consisted of four wetlands in Castilla-La Mancha, a flat region

situated in the Central Spanish Plateau mostly devoted to agriculture. Tablas de Daimiel

is a National Park (TDNP), a Special Protection Area for Birds and it is included in the

Ramsar List. It protects the remaining 1,675 ha of a floodplain wetland that 50 years ago

comprised 6,000 ha. Navaseca lake (24.3 ha) is located in the vicinity of TDNP (about

6.5 km) and close to the town of Daimiel. This wetland was seasonal in the past, but now

Capítulo 5

163

it is permanently flooded and highly eutrophic, because it receives the effluent of a

wastewater treatment plant. Prado lake (50.5 ha) close to the town of Pozuelo de

Calatrava is a temporary, endorheic, saline wetland included in the Ramsar List. It also

receives inputs of treated wastewater, so the quality of its water is often deteriorated.

Finally, Calderon lake (49.8 ha) near the town of Moral de Calatrava is also a temporary

and endorheic wetland. All these wetlands are winter refuge and/or breeding site of a

variety of waterbird species including endangered species such as the crested coot (Fulica

cristata), white-headed duck, ferrugineous duck or marbled teal (Marmaronetta

angustirostris). Avian botulism is endemic in the region, where outbreaks have been

attributed to the mosaic C. botulinum type C/D (Vidal et al., 2013; Anza et al., 2014a).

The climate in this area is cold-temperate continental, with a pronounced dry season and

annual rainfall of around 400 to 500 mm. All the wetlands studied are between 603 and

670 m above sea level.

2.2 Counts of living and dead waterbirds

Waterbird counts of live adults and subadults of different species were made just

after sunrise by using binoculars and a telescope at selected points along the shore of

Navaseca lake during outbreak periods. In 2011, five counts were made between July and

August with intervals of around 15 days. In 2012, nine counts were made between the

second half of June and August at weekly intervals (except one missing count at the end

of July). During these periods, one person surveyed the shore of Navaseca every morning

(except weekends), and collected dead and sick birds. Once a week, the survey was also

made by boat to collect dead birds from several small islands located in the center of the

lake. After identifying the species, dead birds were buried in the surrounding fields by


164

Daimiel town council staff, and sick birds were sent to the provincial wildlife

rehabilitation center that belongs to the regional government (Joint of Commonalities of

Castilla-La Mancha, JCCM).

2.3 Sampling of aquatic invertebrates

During outbreak periods, aquatic invertebrates and fishes were sampled in

Navaseca, Prado and Calderon lakes in 2011, and water snails were also sampled in

Navaseca in August 2012. Aquatic invertebrates were captured from the water with a 0.5

mm-mesh-size sieve and aquatic snails were collected with forceps. They were kept alive

in sterile plastic containers until analysis in the following 24 h. In the laboratory, they

were identified and pooled according, at least, to the taxonomic family. Samples of

invertebrates and fishes included specimens of non-biting midge’s larvae (Chironomidae,

n=15), water boatmen (Corixidae, n=24), back swimmers (Notonectidae, n=4),

crustaceans (Ostracoda, Copepoda and Cladocera; n=15), freshwater snails (Physidae,

n=53), beetle larvae (Coleoptera, n=5), mayfly larvae (Ephemeroptera, n=3), soldier fly

larvae (Stratiomyidae, n=2) and mosquito fish (Gambussia affinis, n=8).

2.4 Sampling of waterbird feces and live bird cloacal swabs

Waterbird fecal samples were collected during outbreak and non-outbreak periods

(Table 1). Fecal sampling during outbreak periods was performed in 2011 between late

July and October in Navaseca (n of sampling visits (ns) = 4), Pozuelo (ns = 1) and Moral

lakes (ns = 1). Fecal sampling during non-outbreak periods was performed in 2011

between June and early July in Navaseca (ns = 3) and between August and October in

TDNP (ns = 3); and in 2012, between January and April in Navaseca (ns = 5) and in

Capítulo 5

165

Tablas de Daimiel National Park (ns = 1). In each sampling, around 30 waterbird (ducks,

rails, shorebirds and gulls) fecal samples were collected with sterile swabs and kept at 4

ºC in plastic bags with zip closure until processing during the next 24 h.

Waterbirds bait trapping was done at Navaseca lake once per season in 2012,

using funnel traps on the shore of the lake, were groups of moorhens usually feed. In

previous studies, monitoring of faeces showed the presence of C. botulinum in 2.9% of

droppings of rails, including moorhens (Gallinula chloropus), which suggested that

healthy birds of this species could be carriers of the bacteria (Anza et al., 2014b). Traps

were baited with grain and checked every hour. Captured birds were removed and held in

bags before ringing and sample collection. Birds were marked with a metal ring,

weighed, and tarsus, beak and wing length measured. Age (juvenile or adult) was

determined using plumage criteria (Baker, 1993). A cloacal sample was taken with a

sterile swab and kept in a sterile transport container (APTACA, Copan) until analysis.

After sampling, the birds were released. Cloacal swab samples were also taken from

recaptured birds. A total of 89 moorhens, 1 water rail (Rallus aquaticus) and 1 mallard

were captured in the funnels; from these, 46 individuals were adults, 38 sub-adults and 7

chicks. Nineteen moorhens were recaptured once, two were recaptured twice and one was

recaptured three times. As a reference sample, between March and April 2012, 19

moorhens, 1 coot and 11 mallards were trapped and sampled in Ebro Delta (NE Spain),

where botulism outbreaks are uncommon.

2.5 Fecal excretion of C. botulinum by botulism affected birds

In 2012, botulism intoxicated waterbirds collected during two botulism outbreaks

from Navaseca and Pozuelo lakes were monitored to study the chronology of fecal


166

excretion of C. botulinum type C/D after admission at the regional wildlife rehabilitation

center. Upon admission, birds were marked with color plastic bands and a cloacal sample

was taken with a sterile swab that was kept in a transport container (APTACA, Copan).

The following five days, birds were maintained in nursing pens and received

support treatment consisting on antibiotic therapy (Marbocyl 2%, Vetoquinol), vitamin

complex (Duphafrarl Multi, Pfizer), intravenous fluids (Ringer-lactate) and tube feeding.

During this period another two cloacal swabs were taken on days 3 and 5. After this time,

if birds were recovered they were taken to a bigger enclosure before being released.

During this period, cloacal swabs were taken when birds needed to be handled and before

they were released. The intended sampling scheme was to collect cloacal samples at two

days intervals; however, due to the different times of recovery of each bird and to avoid

interfering with the center´s staff work, the sampling scheme was variable. To confirm

botulism, blood samples from four waterbirds (three from Navaseca and one from

Pozuelo) admitted to the center in a critical condition were collected from the jugular

vein following euthanasia and the sera was tested for botulinum toxin C by the mouse

bioassay neutralization test (CDC, 1998).

2.6 Camara trapping of waterbirds near carcasses in wetlands

To see if waterbirds feed on or around carcasses, camera traps were installed

pointing to bird carcasses located in the shore of Navaseca and Pozuleo lakes during

outbreak periods. In Navaseca, the camera was installed in an island during 4 days in

August 2012. In Pozuelo the camera was installed during 6 days in September 2013 in 3

different locations: 2 days in the surrounding shore, 2 days in one island and 2 days in

another island.

Capítulo 5

167

2.7 C. botulinum type C/D detection

Cloacal swabs, bird faeces and aquatic invertebrates were processed for detection

of C. botulinum type C/D as previously described by Vidal et al. (2011). Briefly, samples

were cultured in 9 ml of commercial cooked meat broth supplemented with vitamin K1,

glucose and hemine (BD BBL Cooked meat medium with glucose, hemin and vitamin K)

using an anaerobe container system (BD GasPakTM 129 EZ) over a period of 3 days at

37 °C. DNA was extracted by boiling the pellet obtained from 1 ml of the culture broth in

300 µl of distilled water. The solution obtained after centrifugation was used as PCR

template. Real time PCR was performed according to Sánchez-Hernández et al. (2008)

for the detection of the genes encoding both type C and type C/D mosaic toxins.

2.8 Statistical analysis

The differences in the susceptibility to botulism between species were studied

with the data of the recorded mortality relative to the census in the previous days (1-2

weeks) in the same wetland. The relative susceptibility of each species was estimated

from the relationship between number of dead birds and census data. This model was

calculated with a General Linear Model procedure with a negative binomial distribution

of counts to avoid over dispersion of data and including date as a covariate. Census date

was expressed as the number of days since the 1st of June. Count of dead/sick birds

recorded between censuses was used as dependent variable, the count of living

individuals recorded in each census, julian day and quadratic julian day of census as

covariables and the year as fixed factor. Then, the standardized residuals of the model

were plotted for each species to obtain the distance of their observed mortality values

from the expected values. Only the most abundant species were considered, i.e. Anatidae


168

(5 species): mallard (Anas platyrhynchos), gadwall (Anas strepera), northern shoveler

(Anas clypeata), European pochard (Aythya ferina), and white-headed duck (Oxyura

leucocephala); Rallidae (2 species): moorhen (Gallinula chloropus) and coot (Fulica

atra); black-necked grebe (Podiceps nigricolli), black-winged stilt (Himantopus

himantopus), black-headed gull (Chroicocephalus ridibundus), and flamingo

(Phoenicopterus roseus). This approach was preferred over a comparison of prevalence

or incidence, because these two parameters would be more biased in case of low live bird

counts. Mortality was also calculated as percentage of death/sick individuals of each

species over the maximum number of individuals of the species recorded in the lagoon.

Fisher exact probability test was used to compare the frequency of detection of C.

botulinum type C/D in bird feces samples collected during outbreak and non-outbreak

periods. It was also used to compare the frequency of the pathogen in cloacal swabs of

different bird species at the wildlife rehabilitation center. Significance for the statistical

analyses was set at P < 0.05. The analyses were performed with IBM SPSS Statistics

19.0.0.

3. Results

3.1 Susceptibility of avian species to botulism

During the census performed in Navaseca lake between 2011 and 2012, 17,574

observations (times that a species is counted) of the 11 selected species were made. The

most common species were coot (4,936 observations), flamingo (2,137), northern

shoveler (2,021), white headed-duck (1,826), black-necked-grebe (1,541), mallard

(1,328), and moorhen (1,183), but differences in the abundance of some species (i.e.

black-headed gull, coot and shoveler) were observed between 2011 and 2012 (Fig. 1A).

Capítulo 5

169

During the same period, 646 dead or sick birds were collected, 357 in 2011 and 289 in

2012 (Fig. 1B).

0 50 100 150 200 250 300 350 400 450 500

Mallard

Shoveler

Gadwall

White-headed duck

Pochard

Coot

Moorhen

Black-winged stilt

Black-headed gull

Black-necked grebe

Flamingo2011

2012

0 20 40 60 80 100 120 140

Others

Mallard

Shoveler

Gadwall

White-headed duck

Pochard

Coot

Moorhen

Black-winged stilt

Black-headed gull

Black-necked grebe

Flamingo2011

2012

Fig. 1. A. Mean number of waterbirds observed (observations) in Navaseca lake during botulism

outbreaks from June to August in 2011 (5 census) and 2012 (9 census). B. Number of dead/sick

waterbirds collected in 2011 and 2012 in Navaseca lake during botulism outbreaks.

In 2011, the first waterbird carcasses were observed in the third week of July and the

number of dead birds increased until mid-August, the last dead birds were collected at the

beginning of October. In 2012, the first dead birds appeared in mid-June and the number

of dead or sick birds reached a peak at the end of June, then it decreased until the end of

August (Fig. 2).

B

A


170

Fig. 2. Number of birds counted (black line) during the census of 2011 and 2012 in Navaseca lake

and the number of death/sick birds collected weekly (in bars) during the botulism outbreaks.

The numbers of affected birds from certain species varied between years:

shovelers, gadwalls, white-headed ducks, moorhens and black-winged stilts were more

affected in 2011, while mallards, gulls, grebes and coots were more affected in 2012 (Fig.

1B). Regarding to the percentage of death/sick birds in relation to the maximum number

of birds counted each year (% in 2011-2012) the most affected birds were: the gadwall

(89-24%), black-winged stilt (85-2%), coot (53-17%), black-headed gull (43-9%),

mallards (11.6-24.7%), pochard (17-11%) and white-headed duck (17-7%). GLM

analysis showed a significant relationship between the number of living birds and the

Capítulo 5

171

number of sick/dead birds for each species at each “between-census” period (Wald’s χ2=

41.34; P<0.001), between the number of dead birds and the julian day of census (Wald’s

χ2= 5.31; P=0.02) and quadratic julian day of census (Wald’s χ

2= 3.94; P=0.05) and that

in 2011 the number of affected birds was significantly higher than in 2012 (Wald’s

χ2=22.46; P<0.001). The plot of the standardized residuals revealed that mallards, coots,

gulls and gadwalls were the most susceptible species to botulism intoxication, while

flamingos and grebes the less susceptible (Fig. 3).

Fig. 3. Susceptibility of different waterbird species to botulism intoxication based on standardized

residuals from GLM, presented as mean ± 95% confidence interval.

Model: Number dead birds = living birds + julian day + julian day2 + year


172

3.2 Detection of C. botulinum type C/D in potential prey of white-headed duck and other

waterbird species

C. botulinum BoNT-C/D gene was detected in 16 out of 53 (30%) samples of

freshwater snails (Physella acuta) and in two out of two soldier fly larvae

(Stratiomyidae). None of the other samples of aquatic invertebrates or fishes yielded C.

botulinum BoNT-C/D genes (Table 1).

Table 1. Aquatic invertebrates collected in Navaseca during botulism outbreaks tested for the

BoNT C/D gene.

Type of invertebrate BoNT-C/D gene positive/total

no of samples analyzed (%)

Snails 16/53 (30)

Beetles 0/5

Water boatmen 0/24

Back swimmer 0/4

Crustacea 0/15

Mayfly 0/3

Soldier fly larvae 2/2 (100)

Fishes 0/8

Chironomids 0/15

Total 18/129

3.3 Excretion of C. botulinum type C/D by free-living birds

None of the 117 cloacal swabs from healthy birds captured in the funnel traps in

Navaseca lake yielded BoNT-C/D genes (Table 2), and neither did the 31 cloacal swabs

from the waterbirds captured in Ebro Delta. During non-outbreak periods 0.8% (N=365)

of waterbird faeces samples yielded BoNT-C/D genes, while during outbreak periods

16.3% (N=153) of faecal samples yielded it; being this difference significant (Fisher

Capítulo 5

173

exact test, P<0.0001; Table 2). Regarding to the excretion by type of bird, 23% of rail

fecal samples, 16% of shorebirds samples and 9% of ducks samples yielded BoNT-C/D

genes when collected during botulism outbreaks; these percentages where not statistically

different. Out of outbreak periods, 1.4% of fecal samples of rails and 1.9% of shorebirds

yielded the gene, while duck samples were negative.

As for the sick birds admitted to wildlife rehabilitation center with botulism signs,

69 individuals from nine species where sampled, 32 of them were finally released and 37

died during the recovery process. Twenty-six (37.7%) of the birds excreted C. botulinum

BoNT-C/D genes at some time during the period at the wildlife rehabilitation center. The

excretion decreased with the time at the center, from 30% BoNT-C/D gene positive

cloacal swabs the day 1 to 0% the day 7; though two individuals, a coot and a gadwall,

excreted it again after the 7th

day, just before being released. Ducks (Anatidae) and rails

(Rallidae) excreted the BoNT-C/D genes more often (P <0.05) and for longer time than

gulls (Laridae) (Fig. 4; Table S1 in supplemental material).

3.4 Camera trapping

The cameras took pictures of different species of shorebirds [common snipes

(Gallinago gallinago), green sandpipers (Tringa ochropus), little ringed plover

(Charadrius dubius), northern lapwings (Vanellus vanellus)], moorhens and mallards

feeding near the carcasses. The camera located in the surrounding shore of Pozuelo lake

took a picture of a fox (Vulpes vulpes) picking up one of the carcasses (Fig. S1)


174

Table 2. Comparison of the prevalence of BoNT-C/D gene in healthy waterbird cloacal swabs and

in feacal samples collected during botulism outbreak and non-outbreak periods.

Wetland status Season Wetland Positive/total (%)

Cloacal swabs Bird faeces

Non-outbreak Early summer 2011 Navaseca - 1/83 (1.2)

Summer 2011 Tablas - 1/62 (1.6)

Autumn 2011 Tablas - 0/34

Winter 2012 Navaseca 0/44 1/106 (0.9)

Spring 2012 Navaseca 0/34 1/56 (1.8)

Tablas - 0/24

Autumn 2012 Navaseca 0/28 -

Total 0/106 4/365 (0.8)

Outbreak Summer 2011 Navaseca - 20/96 (20.8)

Pozuelo - 2/24 (8.3)

Early autumn 2011 Navaseca - 2/27 (7.4)

Autumn 2011 Moral - 0/28

Summer 2012 Navaseca 0/9 1/6 (16.6)

Total 0/9 25/153 (16.3)*

*Prevalence during “outbreak “significantly higher than during “non-outbreak” (Fisher exact test, p<

0.0001).

Fig. 4. Excretion of C. botulinum BoNT-C/D gene by different families of sick waterbirds during

the recovery process at a wildlife rehabilitation centre after a botulism outbreak.

Capítulo 5

175

4. Discussion

In this study, we have observed that susceptibility of different species of

waterbirds to botulism intoxication varied, i.e. mallards and coots were more susceptible

than flamingos and grebes; this was probably influenced by feeding behavior and

temporal wetland use patterns, but some genetic resilience could not be discarded.

Moreover, C. botulinum type C/D toxin genes could be detected in waterbird faeces year

round, at a very low frequency out of outbreak periods and at a markedly higher

frequency during outbreak periods, which shows that waterbirds may harbor C. botulinum

type C/D in their gastrointestinal tract and may act as dispersers of the pathogen between

wetlands. In addition, if these carrier birds die, their carcasses may become substrate for

the growth of C. botulinum and contribute to the start and spreading of the outbreaks; but

do all waterbird species contribute equally to the epidemiology and dispersal of botulism?

Based on the GLM analysis, the most susceptible species in our study were

mallards, followed by coots, black-headed gulls and gadwalls, and the less were

flamingos and grebes; the rest of species seemed to be similarly affected. Accordingly,

the most affected waterbirds during avian botulism outbreaks reported in previous studies

in Spain were mallards, coots, common teals (Anas crecca), black-headed gulls and

shovelers (Contreras de Vera et al., 1987; Vidal et al., 2013); though neither of these

studies took into account the number of healthy individuals of each species at risk of

botulism intoxication. Interestingly, in a previous study carried out in our same study area

which included 13 botulism outbreaks and around 20,000 death waterbird, only 8

individuals of the white-headed duck (“endangered” in the IUCN Red List of Threatened

Species; BirdLife International, 2012) were reported (Vidal et al., 2013), which may have

led to think that this species is not sensitive to botulism. By contrast, in the present study,


176

just during two outbreaks, a total of 43 dead white-headed ducks were collected, which

represented the 7 and the 17% of the maximum census in Navaseca lagoon during 2011

and 2012 respectively. This difference is probably due to the increase in the population of

this species in the last decades in Castilla-La Mancha and it confirms that botulism may

affect the recovery of this species, which is particularly relevant because white-headed

ducks are attracted by wastewater wetlands (Hadad and Moyal, 2007), such as Navaseca,

where the risk of botulism outbreaks is high (Anza et al., 2014b).

Differences in feeding habits may explain variations in susceptibility to botulism

(Rocke, 2006). This fact also indicates that the BoNT toxin concentrates in specific

compartments (i.e. invertebrates) of the wetlands. For example, in a study performed in a

Canadian prairie lake, surface feeder shorebirds seemed more prone to ingest botulinum

toxin than probers (Adams et al., 2003), and based on a literature review and over 2,000

diagnostic records at the USGS National Wildlife Health Center, dabbling ducks are

among the species at greater risk of botulism (Rocke, 2006). Accordingly, in our study,

diving ducks (white-headed duck and pochards) seemed to be less affected than dabbling

ducks and surface feeders (gadwall, mallard and coots). The feeding habits of the

majority of waterbirds are not accurately known and they probably change with the

seasons and the type of prey available in each wetland, which makes it very difficult to

identify possible sources of toxin for each species. Mallards and gulls, which were

between the most susceptible species in this study, are omnivorous and opportunistic

species (Cramps, 1998) and may ingest the botulinum toxin from a variety of sources, as

for example maggots from carcasses which are known to be a major source of toxin

(Duncan and Jensen, 1976; Rocke and Friend, 1999). Coots and gadwalls, also between

the most susceptible species, are mainly herbivorous (Cramps, 1998); so one source of

toxin for them may be freshwater snails which are frequently observed on plants and on

Capítulo 5

177

carcasses (personal observation). In this study 30% (N= 53) of freshwater snails (Physella

acuta) collected during outbreaks yielded BoNT-C/D genes; this snail eats detritus where

it may acquire C. botulinum and its toxin. Previous studies also reported an association

between water snails and carcasses and detected BoNT-C toxin in their tissues (Duncan

and Jensen, 1976). Interestingly, Physella acuta is a globally invasive species of

gasteropod originated in North America (Albrecht et al., 2009) and is characterized by a

high reproductive rate, high passive dispersal capacities and high tolerance to polluted

water (Bernot et al., 2005). Previous studies have linked invasive species with the

(re)emergence of avian botulism type E in several locations of the Great Lakes of North

America where the invasion of dreissenid mussels (Dreissena bugensis and Dreissena

polymorpha) and round gobies (Neogobius melanostomus) presumably have produced

habitat transformations and the development of anoxic conditions that favored C.

botulinum (Getchell and Bowser, 2006). It is possible that the invasive freshwater snails

also facilitate avian botulism outbreaks by serving as an important source of toxin for

waterbirds due to their abundance and their necrophagous habits. Further research about

toxin concentration in water snails is needed to determine their epidemiologic

importance. On their part, flamingos and black-necked grebes probably do not include

preys that harbor the botulinum toxin in their diets. Flamingos primarily feed on artemias

(Artemia spp.) or alternatively prey chironomid larvae (Deville et al., 2013) and black-

necked grebes actively prey on artemias and other invertebrates such as corixids (Varo et

al., 2011); we have analyzed a relevant number of samples of chironomids, corixids and

crustaceans and they did not yield BoNT C/D genes, including specimens captured during

outbreak periods (Anza et al., 2014b). Alternatively, as flamingos and grebes are

genetically closely related (Hackett et al., 2008), there is the possibility that these species

are more resistant to the toxin, as is the case of vultures (Rocke and Friend, 1999). With


178

the images taken with the camera traps, we can confirm that some waterbirds could get

intoxicated while feeding near carcasses, which are the major source of toxin, and also

we point out that scavengers, such as foxes, may clean up a great proportion of the

carcasses in the surrounding area of the wetlands helping to the control of the outbreaks.

A bigger sampling effort with the camara trap would give further information about how

different waterbirds get intoxicated.

Another factor which influenced the number of dead birds of certain species due

to botulism was the temporal wetland use patterns, as it may be the case of shovelers and

black-winged stilts. In 2011, large flocks of shovelers arrived to Navaseca at the end of

summer coinciding with the peak of mortality and resulting in a high proportion of dead

shovelers. Meanwhile, in 2012, the peak of mortality occurred at the end of June when

they had not arrived to the wetland, so the proportion of dead shovelers was smaller. This

pattern explain the lower than expected susceptibility we recorded for this species, which

is a dabbling duck frequently reported between botulism bird losses (Vidal et al., 2013).

In the case of black-winged stilt, in 2012 the majority of individuals were count in

August when the peak of mortality had passed. This pattern explains the lower mortality

recorded in 2012 than in 2011 in spite of the higher number of individuals counted.

Similarly, Rocke et al. (2005) suggested that brown pelicans (Pelecanus occidentalis)

were more affected by botulism than white pelicans in the Salton Sea because they

arrived earlier in the season.

Very little has been published about excretion of C. botulinum by waterbirds. Our

results indicate that it is a reflection of the abundance of the bacteria in environment

because prevalence in feces (0.8% out of outbreak periods and 16.3% during outbreaks)

was similar to the reported prevalence in sediments (0-2.4% out of outbreak periods and

30% during outbreak periods; Anza et al., 2014b). In Austria, Zechmeinster et al. (2005)

Capítulo 5

179

reported BoNT-C gene in around 80% of waterbird fecal samples, which coincided with

the percentage of sediment positive samples. We did not find C. botulinum in cloacal

swabs of healthy birds indicating that they do not usually excrete it and that this

bacterium does not form part of the normal microbiota of waterbirds, though we cannot

discard that they harbored it in their caecum in small quantities undetectable with a

cloacal swab. Similarly, Hardy and Kaldhusdal (2013) did not find C. botulinum type

C/D in caecum samples from 100 healthy broiler flocks and concluded that botulism is a

sporadic and exogenously acquired event in broiler farms without history of botulism.

Supporting this hypotesis, Vidal et al. (2009) analyzed 24 caecum samples from mallard

hunted in Delta del Ebro where outbreaks are uncommon and all of them resulted

negative. Nevertheless, our findings suggest that C. botulinum passes through the

intestinal tract of healthy waterbirds after ingesting it along with sediment or food items,

and therefore waterbirds may disperse the pathogen, especially during outbreak periods

when the abundance of the microorganism in the environment is higher. Green et al.

(2002) stated that ducks, shorebirds and other waterbirds have great potential as

dispersers of aquatic organisms and that different bird species can have very different

roles in dispersal of specific aquatic organisms. Maximum retention time of propagules of

freshwater invertebrates and algae ingested by waterbirds may reach 24 hours

(Charalambidou and Santamaría, 2002) Moreover, Viana et al. (2013), by means of

mechanistic models, showed that up to 3.5% of estimated waterbirds seed dispersal

distances were longer than 100 km. If these data is applied to C. botulinum, waterbirds

may probably disperse it between distant wetlands. In this sense, the PFGE

characterization of C. botulinum type C/D strains isolated from botulism intoxicated bird

samples collected in Sweden and Spain showed that they were genetically very similar

(Anza et al., 2014a; Skarin et al., 2010), which supports the hypothesis that waterbirds


180

may have spread C. botulinum type C/D during their migratory routes across Europe

(Woudstra et al., 2012).

The results obtained at the wildlife rehabilitation center showed that up to 37.7%

of sick birds may excrete C. botulinum type C/D and that, even under antibacterial

treatment, a few birds (6%) still excreted C. botulinum after the seventh day when they

were already recovered. Moreover, ducks and rails excreted C. botulinum type C/D more

often than gulls probably due to differences in the morphology of the digestive system. In

particular, the functionality of the caecum influences the retention time because it is

blind-ended and retains contents for longer periods of time (Clench and Mathias, 1992).

Moreover, anaerobic microbiota is predominant in this organ (Clench and Mathias,

1995), where C. botulinum has already been detected (Reed and Rocke, 1992; Vidal et

al., 2011). Ducks and rails have larger caecums than gulls and, in general, herbivores and

omnivores have larger caecums than piscivores and granivores (Clench and Mathias,

1995). In fact, in this study and a previous one, we found that the majority of positive

fecal samples belonged to rails (Anza et al., 2014b). This finding suggests that the

waterbird species with larger caecum may harbor and disperse the pathogen for longer

periods thus having a more important role in the dispersal of avian botulism.

The persistence of C. botulinum in the digestive tract indicates that it may remain

for some time as part of the intestinal microbiota, but further confirmation of this would

be necessary, because one may then expect to find cases of toxiinfectious botulism in

wild waterbirds (as described in foals and children and suggested for broilers [Dohms et

al., 1882; Midura, 1996; Swerczek et al., 1980]) if C. botulinum could replicate and

produce BoNt in the caecum of birds.

Capítulo 5

181

5. Conclusions

Susceptibility to botulism intoxication is different for each waterbird species and

it depends on feeding behavior and temporal wetland use patterns but also some

interspecies genetic component may exist. This implies that concentrations of highly

susceptible species during high-risk botulism periods may increase the likelihood of an

outbreak and the mortality rate. In this study, the threatened white-headed duck was not

between the most susceptible species, but botulism killed around the 7 and 17% of the

individuals inhabiting the studied lagoon, so this disease should be consider in future

conservation programs. Between the sources of intoxication for some waterbird species,

the invasive water snail Physella acuta may be particularly important as it is very

abundant in some wetlands and frequently harbor C. botulinum. Finally, even though C.

botulinum does not seem to form part of the normal microbiota of healthy waterbirds,

they may excrete and disperse it between wetlands after ingesting it from the

environment; but not all the species have the same potential as dispersers, species with

larger caecum, such as gadwalls and coots, may maintain and excrete it for longer

periods.

Acknowledgments

We thank Raúl, Alejandro del Moral and personal from Tablas de Daimiel

National Park for helping with the identification and collection of sick and dead

waterbirds. We also thank Juan Andrés for his assistance at the wildlife rehabilitation

center. This study was supported by the Spanish Ministry of Environment (grants OAPN

035/2009). I. Anza was supported by a JAE PRE grant from the Spanish Council of

Research (CSIC).


182

References

Adams, S.G., Conly, F.M., Gratto-Trevor, C.L., Cash, K.J., Bollinger, T. 2003. Shorebird

use and mortality at a large Canadian prairie lake impacted by botulism.

Waterbirds 26, 13-25.

Albrecht, C., Kroll, O., Moreno, E., Wilke, T. 2009. Invasion of ancient Lake Titicaca by

the globally invasive Physa acuta (Gastropoda: Pulmonata: Hygrophila).

Biological Invasions 11, 1821–1826.

Anza, I., Skarin, H., Vidal, D., Lindberg, A., Båverud, V., Mateo, R. 2014a. The same




Mateo, R. 2014b. Eutrophication and bacterial pathogens as risk factors for avian

botulism outbreaks in wetlands receiving effluents from urban wastewater

treatment plants. Applied and Environmental Microbiology 15, 4251-4259.

Baker, K. (Ed.). 1993. Identification guide to European non-passerines. British Trust for

Ornithology, London.

Bernot, R.J., Kennedy, E.E., Lamberti, G.A. 2005. Effects of ionic liquids on the

survival, movement, and feeding behavior of the freshwater snail Physa acuta.

Environmental Chemical Toxicology 24, 1759–1765.

BirdLife International 2012. Oxyura leucocephala. En: IUCN 2014. IUCN Red List of

Threatened Species. Version 2014.1. <www.iucnredlist.org>. Descargado el 3 de

Julio 2014.

Centers for Disease Control and Prevention (CDC): Botulism in the United States, 1899-

1996. 1998. Handbook for Epidemiologists, Clinicians, and Laboratory Workers,

Capítulo 5

183

Atlanta, G.A. Centers for Disease Control and Prevention.


Charalambidou, I., Santamaría, L. 2002. Waterbirds as endozoochorous dispersers of

aquatic organisms: a review of experimental evidence. Acta Oecologica 23, 165–

176.

Chou, S.J., Shieh, Y.C., Yu, C.Y. 2008. Hematologic and biochemistry values for black-

faced spoonbills (Platalea minor) with and recovering from botulism. Journal of

Wildlife Disease 3, 781-784.

Clench, M.H., Mathias, J.R. 1992. Intestinal transit: how can it be delayed long enough

for birds to act as long-distance dispersal agents? Auk 109, 933–936.

Clench, M.H., Mathias, J.R. 1995. The avian cecum: a review. Wilson Bulletin 107, 93–

121.

Contreras de Vera, A., León-Vizcaíno, L., Carranza, J., Hermoso de Mendoza, M.,

Garrido, F. 1987. Botulismo aviar en zonas húmedas de la campiña de Sevilla y

Córdoba. Medicina Veterinaria 4, 173–179.

Cramp, S. 1998. The complete birds of the Western Palearctic on CD-ROM. Oxford

University Press, Oxford.

Deville, A.S., Grémillet, D., Gauthier-Clerc, M., Guillemain, M., Von Houwald, F.,

Gardelli, B., Béchet, A. 2013. Non-linear feeding functional responses in the

Greater Flamingo (Phoenicopterus roseus) predict immediate negative impact of

wetland degradation on this flagship species. Ecology and Evolution 3, 1413–

1425.

Dohms, J.E., Allen, P.H., Rosenberger, J.K. 1982. Cases of type C botulism in broiler

chickens. Avian Diseases 26, 204-210.



184

Dover, N., Barash, J.R., Hill, K.K., Xie, G., Arnon, S.S. 2014. Molecular characterization

of a novel botulinum neurotoxin type H gene. Journal of Infectious Diseases 209,

192–202.


invertebrates in the epizootiology of avian botulism. Journal of Wildlife Diseases

12, 116–126.



Getchell, R.G., Bowser, P.R. 2006. Ecology of type E botulism within dreissenid mussel

beds. Aquatic Invaders 17, 1-8.

Green, A.J, Figuerola, J., Sánchez, M.I. 2002. Implications of waterbird ecology for the

dispersal of aquatic organisms. Acta Oecologica 23, 177–189.

Hackett, S.J., Kimball, R.T., Reddy, S., Bowie, R.C.K., Braun, E.L., Braun, M.J.,

Chojnowski, J.L., Cox, W.A., Han, K.L., Harshman, J., Huddleston, C.J., Marks,

B.D., Miglia, K.J., Moore, W.S., Sheldon, F.H., Steadman, D.W., Witt, C.C.,

Yuri, Y. 2008. A phylogenomic study of birds reveals their evolutionary history.

Science 320, 1763-1768.

Hadad, E., Moyal, C. 2007. Preference of the White-headed duck Oxyura leucocephala

for wastewater reservoirs in the Judean Plain, Israel. Sandgrouse 29, 70-78.

Hardy, S.P., Kaldhusdal, M. 2013. Type C and C/D toxigenic Clostridium botulinum is

not normally present in the intestine of healthy broilers. Veterinary Microbiology

30, 466-468.

Midura, T.F. 1996. Update: infant botulism. Clinical Microbiology Reviews 9, 119-125.



Capítulo 5

185



Rocke, T.E., Friend, M. 1999. Avian botulism. In Friend, M., Franson, J.D. (eds), Field


National Wildlife Health Center, Washington, USA. p 271-281


avian botulism outbreaks in wetlands. Journal of Wildlife Management 63, 1249-

1260.

Rocke, T.E., Converse, K., Meteyer, C., Mclean, R.G. 2005. The impact of disease in the

American white pelican in North America. Waterbirds 28 (Special Publication 1),

87-94.


C.A., Stroud, D.A. (eds), Waterbirds around the world, The Stationery Office,




products by real time versus capillary gel electrophoresis methods. European Food

Research and Technology 227, 495–502.

Shutt, J.L., Andrews, D.W., Weseloh, D.V.C., Moore, D.J., Hebert, C.E., Campbell,

G.D., Williams, K. 2014. The importance of island surveys in documenting

disease-related mortality and botulism E in Great Lakes colonial waterbirds.

Journal of Great Lakes Research 40, 58–63.





186

Swerczek, T.W. 1980. Experimentally induced toxicoinfectious botulism in horses and

foals. American Journal of Veterinary Research 41, 348-350.

Varo, N., Green, A.J., Sánchez, M.I., Ramos, C., Gómez, J., Amat, J.A. 2011.

Behavioural and population responses to changing availability of Artemia prey by

moulting black-necked grebes, Podiceps nigricollis. Hydrobiologia 664, 163–171.

Viana, D. S., Santamaría, L., Michot, T.C., Figuerola, J. 2013. Allomeric scaling of long-

distance seed dispersal by migratory birds. The American Naturalist 181, 649-662.

Vidal, D., Taggart, M.A., Höfle, U., González, R., Cifuentes, A., Sánchez-Hernández, L.,

Barcenilla, J., Jiménez, B., Green, A.J., Mateo, R. 2009. Análisis del riesgo de

intoxicación por botulismo en malvasía cabeciblanca y otras especies de aves

acuáticas en las Tablas de Daimiel y humedales cercanos. En: L. Ramírez & B.

Asensio (Eds.) Proyectos de Investigación en Parques Nacionales 2005-2008.

Organismo Autónomo Parques Nacionales, Ministerio de Medio Ambiente,

Madrid. p. 229-247.



type C in non-permanent Mediterranean wetlands. Applied and Environmental



reaction for the detection of toxigenic Clostridium botulinum type C1 in waterbird

and sediment samples: comparison with other PCR techniques. Journal of

Veterinary Diagnostic Investigation 23, 942–946.


33, 181–186.

Capítulo 5

187





Bäyon-Auboyer, M.H., Buffereau, J.P., De Medici, D., Fach, P. 2012. Neurotoxin

gene profiling of Clostridium botulinum types C and D native to different

countries within Europe. Applied and Environmental Microbiology 78, 3120-

3127.

Zechmeister, T.C., Kirschner, A.K, Fuchsberger, M., Gruber, S.G., Suess, B.,




185–195.

188

Supplemental material

Table S1. Excretion of C. botulinum BoNT type C/D gene by different species of sick waterbirds during the recovery process at a wildlife rehabilitation centre

after a botulism outbreak

Family Species Positive/total (%)

Cloacal swabs (time of excretion) *

Individuals* 1 day 3 day 5 day 7 day >7 day†

Anatidae Anas platyrhynchos 7/11 (63.6) 7/11 (63.6) 3/6 (50) 0/1 0/1 0/8

Anas strepera 4/9 (44.4) 3/9 (33.3) 1/4 (25) 1/2 0/1 1/5 (20)

Aythya ferina 2/3 (66.7) 1/3 (33.3) 0/2 0/1 0/1 0/1

Oxyura leucocephala 1/5 (20) 1/5 (20) 0/1 1/1 - -

Total 14/28 (50)A 12/28 (43.3)

A 4/13 (30.7) 2/5 (20) 0/3 1/14 (7.1)

Rallidae Fulica atra 8/19 (42.1) 4/19 (21) 5/17 (29.4) 3/11 (27.2) 0/9 1/12 (8.3)

Gallinula chloropus 1/2 (50) 1/2 (50) - - - -

Total 9/21 (42.8)A 5/21 (23.8)

A 5/17 (29.4) 3/11 (27.2) 0/9 1/12 (8.3)

Laridae Chroicocephalus ridibundus 1/18 (5.5) 1/18 (5.5) 0/9 0/7 0/8 0/4

Larus fuscus 1/1 (100) 1/1 (100) - - - -

Total 2/19 (10.5)B 2/19 (10.5)

B 0/9 0/7 0/8 0/4

Podicipedidae Podiceps nigricollis 1/1 (100) 1/1 (100) 0/1 - - -

Total 1/1 (100)AB

1/1 (100)AB

0/1 - - -

Total 26/69 (37.7) 20/69 (30) 9/40 (22.5) 5/23 (21.7) 0/20 2/30 (6.7)

*Percentages of the presence of C. botulinum were significantly different between bird families with a different superscript capital letter.

†One mallard, 1 gull and 2 coots have been sampled 2 times and another coot 3. The total number of birds sampled is 24.

Capítulo 5

189

Fig. 1S. Different species of waterbirds feeding around carcasses and a fox picking up a carcass.


190

DISCUSIÓN GENERAL

El botulismo aviar causa mortalidades masivas de aves acuáticas en todos los

continentes menos en la Antártida, pero ha sido mayoritariamente estudiado en

Norteamérica y Europa. Los brotes ocurren principalmente en humedales de agua dulce

durante el verano, aunque también se han descrito en zonas costeras afectando a

gaviotas (Rocke, 2006; Neimanis et al., 2007). Esta enfermedad afecta a un gran

número de especies de aves acuáticas, incluyendo algunas en peligro de extinción, para

las cuales un solo brote podría tener consecuencias nefastas si sus individuos estuviesen

concentrados en unos pocos humedales (Chou et al., 2008; Work et al., 2010). También

se ha sugerido que el botulismo puede estar entre las causas del declive de algunas

especies como el ánade rabudo (Anas penelope) en Estados Unidos, el cual ha sufrido

miles de bajas debidas a esta enfermedad (Friend et al., 2001).

En España, se registran brotes de botulismo aviar casi anualmente desde los años

70 (León-Vizcaíno et al., 1979), tanto en el norte como en el sur del país. En los

humedales manchegos, donde se enmarca esta tesis, es una enfermedad endémica que

produce brotes casi todos los veranos y otoños, incluyendo algunos especialmente

severos como los ocurridos en varias lagunas situadas en el norte de Ciudad Real en

1978, con alrededor de 6.000 aves afectadas, y en Las Tablas de Daimiel en 1999, con

alrededor de 11.000. Con los estudios de esta tesis queremos ampliar los conocimientos

sobre esta enfermedad que afecta cada año a uno de los principales recursos naturales de

la provincia, las aves acuáticas.

Discusión general

191

1. El agente causante de los brotes

En un principio los brotes de botulismo aviar en España se atribuían a C.

botuinum tipo C (León-Vizcaíno et al., 1979), pero posteriormente se descubrió que en

Europa estaba más extendido el mosaico C/D (Woudstra et al., 2012). Este mosaico es

más letal para las aves y con los medios convencionales como el bioensayo y PCR no

específicas es difícil de diferenciar del tipo C (Takeda et al., 2005). Por ello

investigamos si el mosaico C/D también se distribuía en España (capítulos 1 y 2). Así,

durante una estancia en el Instituto Nacional de Vaterinaria de Suecia (SVA en

Uppsala), aislamos varias cepas de C. botulinum procedentes de cadáveres de aves

muertas por botulismo en tres humedales manchegos, las caracterizamos por PCR y las

pulsotipamos por electroforesis en gel de campo pulsante (EGCP). Las diferentes cepas

resultaron ser tipo C/D y al compararlas genéticamente con cepas suecas, resultaron ser

muy similares o iguales, lo que apoya la hipótesis de una expansión clónica del mosaico

C/D por Europa, probablemente transportada por aves acuáticas. También observamos

que las cepas eran compartidas entre aves domésticas y salvajes. De todas formas, la

técnica EGCP puede no ser suficientemente discriminante, como se ha demostrado para

C. botulinum tipo A (Raphael et al., 2014), y se deberían hacer estudios con técnicas

más finas para ver hasta qué punto las cepas de C. botulinum tipo C/D en Europa son

clónicas y si se podrían diferenciar con vistas a futuros estudios epidemiológicos. En el

capítulo 2 mediante técnicas de PCR convencional (Takeda et al., 2005) analizamos un

mayor número de muestras de tejidos de aves y ambientales recogidas durante brotes de

botulismo en humedales manchegos y volvemos a confirmar que C. botulinum tipo C/D

es el causante de los brotes en nuestro país, o al menos en la provincia de Ciudad Real.

La presencia de este mosaico ya había sido “intuida” en los trabajos realizados en los 80


192

en lagunas andaluzas, donde se describe cierta acción de la antitoxina D (además de la

C) en los test de neutralización realizados para caracterizar la toxina botulínica en suero

de aves enfermas (Contreras de Vera et al., 1987). Así concluimos que en España, como

en muchas otras regiones de Europa, el agente causante del botulismo aviar es

Clostridium botulinum tipo C/D.

2. Historial de brotes en La Mancha Húmeda (Ciudad Real y Cuenca)

y las aves afectadas

El primer paso para comprender las causas del botulismo aviar en la región fue

recopilar información sobre el historial de brotes en La Mancha Húmeda (humedales

situados entre Ciudad Real y Cuenca) y buscar factores ambientales que los causen

(capítulo 2). Para ello, la Junta de Comunidades de Castilla la Mancha nos facilitó

información sobre los brotes acontecidos entre 1978 y 2008. En ese periodo se

produjeron 13 brotes de botulismo (Fig. 1) que afectaron a más de 20.000 aves de más

de 50 especies (ver material suplementario del capítulo 2).

1978

Varias lagunas entre Alcázar-Pedro Muñoz

1998

Alcázar-Pedro MuñozRetama-Manjavacas

1999

Tablas de Daimiel

2002

Alcázar

2004

Jabalón

2005

Jabalón

Vicario

2008

Alcázar

Navaseca

2006

Alcázar

Pedro Muñoz

2007

Tablas de Daimiel

Fig. 1. Cronología de brotes de botulismo en La Mancha-Húmeda entre 1978 y 2008. Alcázar,

Pedro Muñoz, Retama-Manjavacas y Navaseca son lagunas que reciben aguas residuales de

estaciones depuradoras.

Discusión general

193

Probablemente el número estimado de aves muertas es mayor porque muchos

brotes de botulismo pasan desapercibidos o no se registran y, además, los trabajos de

recogida de cadáveres no son eficientes al 100%, por ejemplo, Cliplef y Wobeser (1993)

estimaron que durante sólo se recoge una tercera parte de los cadáveres aunque dicha

eficiencia puede variar con las características y dimensiones de cada humedal. Entre las

especies más afectadas en el periodo de estudio estuvieron los ánades azulones,

seguidos de las fochas comunes, ánades frisos, cucharas comunes, cercetas y gaviotas

reidoras. Estas especies también han sido descritas en otros trabajos como muy

afectadas por el botulismo pero, dado que en ninguno de estos estudios se realizaron

censos, no está claro si el gran número de pérdidas es debido a su abundancia o a que

realmente son más susceptibles a la intoxicación. Por ello, en el capítulo 5, hicimos una

estima de la susceptibilidad de las especies de aves acuáticas más comunes en la

provincia recopilando datos de mortalidad en función del número de aves censadas y

momento del brote. Coincidiendo con los datos del primer estudio, encontramos que los

ánades azulones (Anas platyrhynchos), fochas (Fulica atra), frisos (Anas strepera) y

gaviotas (Chroicocephalus ridibundus), son más susceptibles que otras aves

filogenéticamente más distantes de anátidas y rállidos como los zampullines

cuellinegros (Podiceps nigricollis) y flamencos (Phoenicopterus roseus). Estas

diferencias en susceptibilidad parecen estar muy asociadas al tipo de alimentación. Aves

que se alimentan en superficie y/u omnívoras son más susceptibles que las buceadoras

y/o especialistas, probablemente porque las probabilidades de ingerir larvas de mosca

tóxicas son mayores. De hecho, con las imágenes obtenidas con las cámaras trampas

observamos como varias especies de limícolas se alimentaban en la superficie alrededor

de los cadáveres. Estas diferencias en susceptibilidad asociadas a alimentación también

nos indican que la toxina botulínica se encuentra en compartimentos determinados en


194

los humedales (i.e. invertebrados acuáticos) y que no está libre en el agua. Otros autores

también han observado que aves generalistas y/o que se alimentan en superficie sufren

un mayor número de bajas por botulismo (Rocke, 2006; Adams et al, 2003; Shutt et al,

2014). Además, observamos que la malvasía cabeciblanca (Oxyura leucocephala),

especie en peligro de extinción, es susceptible a la enfermedad. Esto debe ser tomado en

cuenta en programas de conservación considerando la afinidad de esta especie por

humedales de aguas residuales, en los que como posteriormente veremos, el riesgo de

botulismo es elevado. Este estudio sobre susceptibilidad se realizó en un único humedal

por lo que para obtener resultados extrapolables a otras zonas, se debería ampliar en

más humedales. Con este tipo de datos de mortalidad, se podría llegar a conocer el

impacto del botulismo sobre ciertas especies y priorizar medidas de conservación

destinadas a evitar brotes en el caso de especies muy sensibles.

3. Factores ambientales relacionados con los brotes y el problema de

las aguas residuales

De los factores ambientales estudiados en el capítulo 2 (temperaturas mínimas,

máximas y medias, número de días con temperatura mayor de 25 ºC, lluvia media y

humedad media), sólo encontramos relación entre la mortalidad durante los brotes y la

temperatura media en julio. Además, se observó que la mayoría de los brotes se daban

en humedales que reciben aguas residuales (Fig. 1), muy abundantes en La Mancha, e

incluso se dio un brote fuera de temporada estival, entre septiembre y diciembre, tras

unas fuertes lluvias que sobrecargaron la depuradora de Navaseca con la consiguiente

entrada de agua muy contaminada en el humedal a través de un dispositivo de by-pass.

Discusión general

195

Las aguas residuales, aunque no existen estudios previos que lo confirmen, están

descritas como un factor de riesgo para la aparición de botulismo ya que aportan

muchos nutrientes que eutrofizan el agua, y materia orgánica que pueden consumir el

oxígeno del fondo del humedal, produciendo condiciones adecuadas para la

proliferación de microorganismos anaerobios como C. botulinum (Rocke y Friend,

1999; Murray y Hamilton, 2010). Además, después del brote producido en Navaseca

tras las fuertes lluvias, nosotros especulamos que junto con las aguas residuales, entran

en el humedal enterobacterias que pueden producir mortalidades entre las aves acuáticas

y desencadenar los brotes de botulismo, los cuales se propagarán por el ciclo “larva de

mosca-cadáver” (Rocke, 2006). Dado que en Castilla-La Mancha existen muchos

humedales abastecidos con aguas residuales e incluso se ha propuesto solventar los

periodos de sequía en Las Tablas de Daimiel utilizando este tipo de aguas depuradas, en

el capítulo 3 nos propusimos realizar una monitorización anual comparando dos

humedales que reciben agua de depuradoras (La Veguilla y Navaseca) y un control (Las

Tablas) para buscar diferencias que demuestren asociaciones entre las aguas residuales

y los brotes de botulismo. En primer lugar, encontramos que en los humedales con

aguas residuales, la carga de enterobacterias potencialmente patógenas para las aves

como Escherichia coli patógena para las aves (APEC) y Clostridium perfringens tipo A

es significativamente mayor que en Las Tablas, lo que apoya la hipótesis de que en

estos humedales las mortalidades por otras enfermedades puedan ser más frecuentes y

por lo tanto desencadenen brotes de botulismo. Además, en la laguna de Navaseca,

donde se produjo un brote durante el estudio, la temperatura del agua y la concentración

de clorofila (signo de eutrofización) fueron mayores, y el potencial redox menor que en

los otros humedales, factores previamente asociados con el riesgo de brotes de

botulismo (Rocke y Samuel, 1999; Murphy et al., 2000; Pérez-Fuentetaja et al., 2011).


196

También en esta laguna, detectamos cambios bruscos en parámetros ambientales

provocados por la eutrofización de las aguas previos al brote que indicaron la

producción de condiciones anaeróbicas en sedimentos y que coincidieron con el

aumento en la detección de C. botulinum tipo C/D en ellos. Estos cambios fueron la

bajada de la clorofila, sulfatos, potencial redox, y DBO5 y la subida en carbono

inorgánico. A estas diferencias entre humedales y cambios en parámetros ambientales se

añade que la presencia de C. botulinum tipo C/D fue mayor en los humedales

abastecidos con aguas residuales tratadas que en Las Tablas, pudiendo ser debido al

mayor número de brotes registrados en estos o a las mejores condiciones que se dan en

sus sedimentos para el establecimiento de la bacteria. Por último, el vertido de aguas

altera la hipersalinidad propia de muchos humedales manchegos, especialmente los de

la zona de Alcázar, y como vimos en el capitulo 2 y se ha demostrado en otros estudios

(Segner et al., 1971; Webb et al., 2007), la salinidad o la concentración de cloruros

podría ser un factor limitante para el crecimiento de C. botulinum. Con todo esto, en el

capitulo 3 demostramos como las aguas residuales deficientemente tratadas que se

vierten en los humedales manchegos son un factor de riesgo para la aparición de brotes.

Este problema se agrava porque en épocas de sequía, que pueden ir en aumento con el

cambio climático, estos humedales sostienen altas concentraciones de aves acuáticas,

momento en que un brote puede tener consecuencias nefastas. Por ello se deben mejorar

los sistemas de las estaciones depuradoras de aguas residuales (EDAR), muchas de ellas

obsoletas, y eliminar los sistemas by-pass que permiten que aguas casi sin tratar entren

en los humedales cuando estas EDAR se sobrecargan. También debería plantearse

verter las aguas depuradas en humedales construidos y respetar los naturales, ya que

estos tienen unas condiciones naturales (i.e. salinidad) y ciclos hidrológicos

Discusión general

197

característicos que se ven alterados con el vertido de este tipo de aguas (Cooke et al.,

1990; Florín y Montes, 1999).

4. Las moscas como vectores de C. botulinum tipo C/D

Se han dedicado muchos estudios al ciclo “larva de mosca-cadáver”, por el cual

las aves se intoxican al ingerir larvas tóxicas desarrolladas sobre cadáveres en los que se

ha producido toxina botulínica y posteriormente mueren generando más sustrato para la

producción de toxina, haciendo que los brotes se expandan de manera semejante a una

enfermedad infecciosa (Wobeser, 1997; Rocke y Friend, 1999; Rocke, 2006). Sin

embargo, no se ha dedicado mucha atención al posible papel de moscas adultas como

vectores de C. botulinum y propagadoras de brotes. Nosotros, en nuestros primeros

estudios detectamos moscas calíforas, capturadas cerca de cadáveres, positivas a C.

botulinum tipo C/D (capitulo 2). Anteriormente, Duncan y Jensen (1976) habían

descrito moscas, también capturadas cerca de cadáveres, portadoras de la toxina

botulínica tipo C. Las moscas son vector de un gran número de enfermedades (Cohen et

al., 1991; Nazni et al., 2005; Lindsay et al., 2012), por lo que también lo podrían ser

para el botulismo. En el monitoreo realizado en el capitulo 3, tras capturar moscas no

asociadas a cadáveres a lo largo de un año en tres humedales diferente, solo detectamos

2 pooles de moscas positivas a C. botulinum capturadas durante y justo después de un

brote en la laguna de Navaseca, lo que sugería que normalmente no portan C. botulinum

pero que sí pueden hacerlo. Por ello, en el capítulo 4, nos centramos en esta hipótesis y

realizamos un mayor esfuerzo de muestreo durante momentos de brote, que junto con

experimentos laboratoriales, nos permitieron confirmar que las moscas, sobre todo

sarcófagas y calíforas, pueden transportar C. botulinum y excretarlo al menos durante 12


198

horas. Además, confirmamos que las moscas y otros invertebrados necrófagos (i.e.

escarabajos de la familia Dermestidae) son capaces de llevar un número suficiente de

microorganismos de C. botulinum a cadáveres previamente “libres” del patógeno para

que se produzcan sobre ellos larvas positivas al patógeno, ayudando así a la propagación

de los brotes. En este estudio, un 27% de cadáveres de aves previamente negativos a C.

botulinum tipo C/D colocados en humedales con brote y solamente accesible a

invertebrados voladores (moscas y escarabajos necrófagos), desarrollaron larvas

positivas a C. botulinum tipo C/D. Dadas las bajas prevalencias generales del patógeno

que se observan en el ambiente (6% en sedimentos; 3,7% en heces; capítulos 2 y 3), el

papel de las moscas como propagadoras de brotes puede ser importante. Para llegar a

conclusiones más concretas, serían necesarios estudios en los que se pudiesen comparar

brotes de botulismo en presencia de moscas y sin moscas, para ver hasta qué punto estas

tienen un papel en la propagación, y también sería interesante comprobar si C.

botulinum puede multiplicarse en el tracto gastrointestinal de las moscas, como se ha

demostrados para Bacillus anthracis (Fasanella et al., 2010), con lo que además

tendrían un papel magnificador. Otro aspecto interesante desde el punto de vista

ecológico, es que la relación entre C. botulinum tipo C/D y las moscas podría ser

estudiada como un mutualismo, dado que ambos organismos obtienen beneficios de su

interacción. Por último, este estudio pone de manifiesto una vez más la importancia de

la rápida recogida y eliminación (enterrados o incinerados) de los cadáveres de aves en

humedales con el fin de evitar la propagación de los brotes.

Discusión general

199

5. Las aves acuáticas como portadoras de C. botulinum tipo C/D

Otra de las preguntas que nos planteamos en esta tesis es si las aves acuáticas

portan C.botulinum tipo C/D en su tracto gastrointestinal, lo que facilitaría que

mortalidades producidas por otras causas, como enterobacterias (más comunes en

humedales con aguas residuales), desencadenasen brotes de botulismo. Además, nos

planteamos que en algunos casos se puedan dar toxiinfecciones en aves silvestres y no

solo intoxicaciones. Para ello, durante el monitoreo de los tres humedales (Navaseca,

Veguilla y Tablas) a lo largo de un año (capítulo 3) recogimos heces para ver si las aves

excretaban C. botulinum tipo C/D y en qué momentos. Como resultado, observamos una

baja prevalencia del patógeno en heces recogidas en Alcázar (0,5%) y Navaseca (3%),

humedales donde los brotes son más habituales. Además, en Navaseca se dio un pico en

la prevalencia justo antes de que se detectasen las primeras aves muertas por botulismo,

indicando que éstas estaban ingiriendo la bacteria de algún lugar que nosotros no

habíamos detectado, como podrían ser sedimentos o cadáveres. Estos datos confirman

que las aves portan el clostridio, y que haciéndolo antes de los brotes podrían

desencadenarlos con su muerte debida a cualquier otra causa. Zechmeister et al, (2005)

también detectó la presencia de C. botulinum tipo C en el 80% de heces de aves

acuáticas procedentes de zonas con brotes y Reed y Rocke (1992) lo detectaron en 21 de

40 muestras de ciegos de aves procedentes de zonas donde los brotes son frecuentes.

Posteriormente, en el capítulo 5, nos centramos en el estudio de la excreción de

C. botulinum tipo C/D por aves sanas y enfermas. En este estudio observamos que las

prevalencias en heces son mucho más altas durante los brotes (16%), que fuera de estos

(1%), lo que coincide con muestras de hisopos cloacales tomados a pollas de agua

(Gallinula chloropus) sanas (0%) y a aves enfermas de botulismo llevadas a un centro


200

de recuperación (40%). Esto indica que la excreción de C. botulinum tipo C/D es un

reflejo de la presencia de la bacteria en el ambiente o una toxiinfección y descartamos

que sea parte de la microbiota normal de las aves. Hardy y Kaldhusdal (2013)

analizaron muestras de ciego de pollos procedentes de 100 granjas sin historia de

botulismo y también llegaron a esta conclusión puesto que todas las muestras fueron

negativas, mientras que sí se detectó C. botulinum tipo C/D en muestras ambientales de

granjas con historia de botulismo. Por otro lado, tras tomar hisopos seriados a aves

enfermas en un centro de recuperación, vimos que la mayoría excretaban la bacteria

entre el primer y el séptimo día de ingreso, excepto dos aves, una focha y un ánade

friso, que la excretaron más tiempo, los días 14 y 11 respectivamente, una vez

recuperados. Estos datos podrían indicar que C. botulinum tipo C/D se mantiene durante

algún tiempo en las aves y que probablemente se reproduzca en el ciego, causando una

toxiinfección. De hecho, Miyazaki y Sakaguchi (1978) demostraron que las aves

enfermaban de botulismo tras la ingestión de esporas, pero si se les ligaba el ciego no lo

hacían. Esto se apoya en que aves con ciegos más desarrollados, como ánades y fochas,

excretaron más tiempo que las gaviotas reidoras (Chroicocephalus ridibundus) las

cuales tienen ciegos menos desarrollados. Por ello, la presencia de C. botulinum tipo

C/D en heces e hisopos cloacales confirma que las aves, en ciertos momentos, pueden

portarlo y que mortalidades por otras causas, como enterobacterias (frecuentes en aguas

residuales) o por propia toxiinfección, pueden desencadenar los brotes, ya que los

cadáveres son el sustrato perfecto para el crecimiento inicial del clostridio. Por último,

cabe destacar que las aves pueden actuar como vehículo de C. botulinum y transportarlo

entre humedales lo que podría ser una causa de la amplia distribución del mosaico C/D

por Europa (Woudstra et al., 2012) como sugerimos en el capítulo 1.

Discusión general

201

6. Invertebrados acuáticos como fuente alternativa de intoxicación

Para que las aves se intoxiquen la toxina debe ser vehiculada hasta ellas en su

alimento, porque como se deduce de las diferentes susceptibilidades de las aves al

botulismo en el capítulo 5, la toxina no está libre en el ambiente. El estudio de Duncan

y Jensen (1976) demuestra que un gran número de invertebrados capturados a menos de

30 cm de cadáveres muertos por botulismo portan la toxina y entre estos los que más la

concentran, en concentraciones relevantes para la epidemiología de los brotes, son las

larvas de moscas, seguidas de coleópteros necrófagos y caracoles acuáticos. Otros

invertebrados positivos a la toxina fueron coríxidos, notonéctidos, anfípodos,

ostrácodos, larvas de quironómidos, larvas de ditiscos y ninfas de efemerópteros, todos

ellos en concentraciones muy bajas, probablemente insuficientes para matar a un ave.

Nosotros en un primer momento, capitulo 2, muestreamos algunos

invertebrados acuáticos capturados cerca de cadáveres durante los brotes y encontramos

positividad en muestras de coríxidos y quironómidos. Pérez-Fuentetaja et al. (2011)

también encuentran varias especies de invertebrados bénticos portadoras de C.

botulinum tipo E y las propone como vehículos del clostridio hacia las aves desde el

sedimento. En el capítulo 3, muestreamos un gran número de invertebrados acuáticos a

lo largo de un año, independientes y asociados a cadáveres, y sólo encontramos

positividad en caracolas acuáticas que identificamos como Physella acuta y en larvas de

coleópteros, ambas especies con hábitos necrófagos. Posteriormente, en el capítulo 5,

donde hacemos un muestreo más intensivo de invertebrados durante los brotes

confirmamos de nuevo que los caracoles acuáticos, Physella acuta, portan C. botulinum

tipo C/D en una alta frecuencia (30% de las muestras analizadas) con lo que pueden ser

una fuente alternativa de toxina después de las larvas de mosca. Además, Physella acuta


202

es una especie invasora con gran tolerancia a la contaminación y un alto índice de

reproducción (Bernot et al., 2005; Albrecht et al., 2009), lo que aumenta su importancia

como fuente de intoxicación en humedales que reciben aguas residuales donde, al

menos en Navaseca, en ciertos momentos se observan un gran número de individuos de

esta especie, muchos de ellos sobre cadáveres. En estudios futuros, para determinar su

importancia real en la epidemiología de los brotes, se debería confirmar si portan

también la toxina y en qué concentración. Por último, tras observar gran abundancia de

Physella acuta durante los picos de mortalidad en los brotes de Navaseca, podría ser

interesante buscar relaciones entre la abundancia de este invertebrado y los índices de

mortalidad por botulismo.

7. Síntesis

En los humedales de La Mancha Húmeda el botulismo aviar es una enfermedad

muy frecuente. En concreto, en Ciudad Real y humedales colindantes de Cuenca se han

registrado 13 brotes entre 1978 y 2008 más al menos otros 9 brotes registrados entre

2010 y 2013. De los datos obtenidos, hemos visto que el índice de mortalidad está

relacionado con las altas temperaturas en el mes de julio y la frecuencia de los brotes

con el aporte de aguas residuales a los humedales. Además, la presencia de C.

botulinum tipo C/D en sedimentos parece estar limitada por la salinidad intrínseca de

alguno de estos humedales y favorecida por el aumento de materia orgánica. También

hemos observado que las moscas adultas y los caracoles acuáticos pueden jugar un

papel importante en la propagación de los brotes. En la figura 2 mostramos un esquema

de los posibles mecanismos implicados en la aparición y propagación de los brotes de

botulismo en humedales manchegos estudiados en esta tesis.

Discusión general

203

Mortalidad

Capítulo 1 y 2

Eh Sulfato Carbono inorgánico

C. botulinum en el medio

Proliferación de Lemna

Temperatura Eutrofización Aguas residuales

Enteropatógenos

Mortalidad

A

B

C

D

Heces

Invertebradosacuáticos

Aves acuáticas

Larvas de mosca

Muerte de fitoplancton

Transporte a otroshumedales

Materia orgánica

DBO5

Anaerobiosis

Cl-

C. botulinum tipo C/D: 13 brotes entre 1978 y 2008 con más de 20.000 aves muertas de 50 especies diferentes

Capítulo 3

Capítulo 1

Capítulo 4

Capítulo 5

E

Invertebrados

acuáticos

Fig. 2. Esquema del funcionamiento de los brotes en humedales manchegos que reciben aguas residuales

según los datos obtenidos en esta tesis; A: Las altas temperaturas, junto con la gran cantidad de nutrientes

y materia orgánica que entran en humedales con las aguas residuales provocan el crecimiento de

fitoplancton y Lemna spp que tapan la luz y acaban con los recursos provocando la muerte del primero.

La gran cantidad de materia orgánica que se acumula provoca la caída del potencial redox en agua y la

producción de condiciones anaerobias en sedimentos como se observa por la caída de los sulfatos (signo

de proliferación de bacterias reductoras de sulfatos) aumento del carbono inorgánico (consecuencia del

metabolismo bacteriano) y caída de la demanda biológica de oxígeno una vez consumida la materia

orgánica a cambio de oxígeno. Estas condiciones anaeróbicas permiten la proliferación de C. botulinum

en el sedimento; B: Las aves e invertebrados acuáticos ingieren esporas y/o toxina del medio; C: La

muerte de aves portadoras de C. botulinum por otras causas (como enterobacterias muy abundantes en

humedales con aguas residuales), por intoxicación o por toxiinfección, genera cadáveres que son el

sustrato más adecuado para el crecimiento del patógeno y producción de altas concentraciones de toxina,

que se acumula en las larvas de mosca y otros invertebrados acuáticos de hábitos necrófagos; D:

Comienza el ciclo “larva de mosca-cadáver”. Las moscas adultas también ayudan a la propagación de la

bacteria entre cadáveres; E: Tras ingerir esporas del medio, las aves portan C. botulinum en su tracto

gastrointestinal, lo excretan y lo transportan entre humedales.


204

Referencias

Adams, S.G., Conly, F.M., Gratto-Trevor, C.L., Cash, K.J., Bollinger, T. 2003.

Shorebird use and mortality at a large Canadian prairie lake impacted by

botulism. Waterbirds 26, 13-25.

Albrecht, C., Kroll, O., Moreno, E., Wilke, T. 2009. Invasion of ancient Lake Titicaca

by the globally invasive Physa acuta (Gastropoda: Pulmonata: Hygrophila).

Biological Invasions 11, 1821–1826.

Bernot, R.J., Kennedy, E.E., Lamberti, G.A. 2005. Effects of ionic liquids on the

survival, movement, and feeding behavior of the freshwater snail Physa acuta.

Environmental Chemical Toxicology 24, 1759–1765.

Chou, S.J., Shieh, Y.C., Yu, C.Y. 2008. Hematologic and biochemistry values for

black-faced spoonbills (Platalea minor) with and recovering from botulism.

Journal of Wildlife Disease 3, 781-784.

Cliplef, D.J., Wobeser, G. 1993. Observations on waterfowl carcasses during a botulism

epizootic. Journal of Wildlife Diseases 29, 8-14.

Cohen, D., Green, M., Block, C., Slepon, R., Ambar, R., Wasserman, S.S., Levine,

M.M. 1991. Reduction of transmission of shigellosis by control of houseflies

(Musca domestica). Lancet 337, 993–997.

Contreras de Vera, A., León, L., Carranza, J., Hermoso de Medoza, M., Garrido, F.

1987. Botulismo aviar en zonas húmedas de la campiña de Sevilla y Córdoba.

Medicina Veterinaria 4, 173-180.

Cooke, J.G., Cooper, A.B., Clunie, N.M.U. 1990. Changes in the water, soil, and

vegetation of a wetland after a decade of receiving a sewage effluent. New

Zealand Journal of Ecology 14, 37-47.

Discusión general

205



Diseases 12, 116–126.

Fasanella, A., Scasciamacchia, S., Garofolo, G., Giangaspero, A., Tarsitano, E., Adone,

R. 2010. Evaluation of the house fly Musca domestica as a mechanical vector for

an anthrax. PLoS ONE 5, e12219. doi:10.1371/journal.pone.0012219.

Florín, M., Montes, C. 1999. Functional analysis and restoration of Mediterranean

lagunas in the Mancha Húmeda Biosphere Reserve (Central Spain). Aquatic

Conservation 9, 97-109.



Hardy, S.P., Kaldhusdal, M. 2013. Type C and C/D toxigenic Clostridium botulinum is

not normally present in the intestine of healthy broilers. Veterinary


León-Vizcaíno, L., Miranda, A., Carranza, J., Perea, A. 1979. Intoxicación botulínica en

aves acuáticas silvestres en la marisma del Guadalquivir (Coto Doñana). Acta

Vertebrata 6, 120-123.

Lindsay, S.W., Lindsay, T.C., Duprez, J., Hall, M.J.R., Kwambana, B.A., Jawara, M.,

Nurudeen, I.U., Sallah, N., Wyatt, N, D'Alessandro, U., Pinder, M., Antonio, M.

2012. Chrysomya putoria, a putative vector of diarrheal diseases. PLoS

Neglected Tropical Diseases 6, e1895. doi:10.1371/journal.pntd.0001895.

Miyazaki, S., Sakaguchi, G. 1978. Experimental botulism in chickens: the cecum as the

site of production and absorption of botulinum toxin. Japanese Journal of

Medical Science and Biology 31, 1-15.


206


2000. Algal toxins – Initiators of avian botulism? Environmental Toxicology

15, 558-567.



Nazni, W.A., Seleena, B., Lee, H.L., Jeffery, J.T., Rogayah, T.A., Sofian, M.A. 2005.

Bacteria fauna from the house fly, Musca domestica (L.). Tropical Biomedicine

22, 225-231.

Neimanis, A., Gavier-Widén, D., Leighton, F., Bollinger, T., Rocke, T., Mörner, T.

2007. An outbreak of type C botulism in herring gulls (Larus argentatus) in

southeastern Sweden. Journal of Wildlife Diseases 43, 327-736.


Clostridium botulinum type E in Lake Erie: inter-annual differences and role of

benthic invertebrates. Journal of the Great Lakes Research 37, 238–244.

Raphael, B.H., Shirey, T.B., Lúquez, C., Maslanka, S.E. 2014. Distinguishing highly-

related outbreak-associated Clostridium botulinum type A(B) strains. BMC




Rocke, T.E., Friend, M. 1999. Avian botulism. In Friend, M., Franson, J.D. (eds), Field


National Wildlife Health Center, Washington, USA. p 271-281



1249-1260.

Discusión general

207


C.A., Stroud, D.A. (eds), Waterbirds around the world, The Stationery Office,


Segner, W.P., Schmidt, C.F., Boltz, J.K. 1971. Enrichment, isolation, and cultural

characteristics of marine strains of Clostridium botulinum type C. Applied

Microbiology 22, 1017–1024.

Shutt, J.L., Andrews, D.W., Weseloh, D.V.C., Moore, D.J., Hebert, C.E., Campbell,

G.D., Williams, K. 2014. The importance of island surveys in documenting

disease-related mortality and botulism E in Great Lakes colonial waterbirds.

Journal of Great Lakes Research 40, 58–63.





2013. Environmental factors influencing the prevalence of Clostridium

botulinum type C in non-permanent Mediterranean wetlands. Applied and


Webb, M.D., Pin, C., Peck, M.W., Stringer, S.C. 2007. Historical and contemporary

NaCl concentrations affect the duration and distribution of lag times from

individual spores of nonproteolytic Clostridium botulinum. Applied and



33, 181–186.


208








3120-3127.

Zechmeister, T.C., Kirschner, A.K, Fuchsberger, M., Gruber, S.G., Suess, B.,




185–195.

Conclusiones

209

CONCLUSIONES

1. El botulismo aviar en los humedales manchegos, y quizás en el resto de España,

está producido principalmente por el mosaico Clostridium botulinum tipo C/D

como ocurre en otros países europeos.

2. Usando la técnica de Electroforesis en Gel de Campo Pulsante (EGCP) se ha

comprobado que las aves salvajes y domésticas comparten cepas de C.

botulinum tipo C/D. Las cepas de este mosaico son genéticamente muy similares

en territorios distantes como España y Suecia, por lo que podrían haber sido

transportadas por aves acuáticas en su ruta migratoria.

3. La temperatura media durante el mes de julio superior a 26 ºC incrementa la

mortalidad asociada a brotes de botulismo aviar, por lo que durante veranos

especialmente calurosos debería aumentarse la vigilancia y retirada de cadáveres

en humedales para evitar o minimizar los brotes de botulismo.

4. El vertido de aguas residuales insuficientemente tratadas en humedales produce

la eutrofización de sus aguas. En verano, debido a las altas temperaturas, se

produce el sobrecrecimiento y muerte del fitoplancton que finalmente

desencadena la producción de condiciones anaerobias en los sedimentos y

permite la proliferación de C. botulinum tipo C/D en ellos, lo que podría explicar

los brotes recurrentes en estos humedales.

5. En los humedales en los que se vierten aguas residuales insuficientemente

tratadas la prevalencia de bacterias patógenas para las aves es mucho mayor que

en los naturales. Estas bacterias pueden producir mortalidades entre las aves

acuáticas que después podrían desencadenar brotes de botulismo cuando las

condiciones ambientales fuesen favorables.


210

6. Las moscas necrófagas pueden portar un número suficiente de células de C.

botulinum tipo C/D entre cadáveres para que el patógeno se multiplique en ellos

y así aumentar el número de larvas tóxicas y la propagación de los brotes. Esta

relación tiene características de un mutualismo, puesto que ambas especies

obtienen beneficios.

7. Las aves excretan C. botulinum tipo C/D en función de la prevalencia del

microorganismo en el ambiente y lo pueden portar entre humedales. La mayoría

de aves afectadas de botulismo ingresadas y tratadas en el centro de

recuperación deja de excretar el microorganismo antes del séptimo día.

8. Las aves que se alimentan en superficie y son generalistas, como los ánades

azulones, gaviotas reidoras, fochas y ánades frisos, son más sensibles a la

intoxicación por botulismo que aves especialistas, como zampullines y

flamencos. Algunos patos buceadores, como la globalmente amenazada

malvasía cabeciblanca también se encuentra entre las especies afectadas

frecuentemente por esta enfermedad.

epidemiología del botulismo aviar en el...

Documents