filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-ccg-7.pdf · all...
TRANSCRIPT
![Page 2: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/2.jpg)
•Las bases biológicas de las filogenias moleculares
•Las diferencias más importantes entre los métodos (que hay atrás de ellos)
•Es casi imposible hacer una filogenia sin errores (pero fácilmente les creemos)
•A pesar de todo, algo dicen la filogenias
En estas horas:
![Page 3: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/3.jpg)
All living things have much in common, in their chemicalcomposition, their germinal vesicles, their cellular structure, andtheir laws of growth and reproduction. … Therefore I should infer… that probably all the organic beings which have ever lived onthis earth have descended from some one primordial form, intowhich life was first breathed.
On the Origin of Species, (1859, page 484)
Charles Darwin 1809-1882
![Page 4: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/4.jpg)
Charles Darwin 1809-1882
![Page 5: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/5.jpg)
Pretende conocer la relación de ancestría-descendencia
de los OTUs (árbol filogenético) a diferentes niveles
taxonómicos, haciendo una reconstrucción de esta relación
con base en diversos caracteres adquiridos por
descendencia directa.
La Filogenética:
![Page 6: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/6.jpg)
Biología comparada
![Page 7: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/7.jpg)
![Page 9: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/9.jpg)
>gi|115495852|ref|NM_001076536.1| Bos taurus myosin binding protein C, cardiac (MYBPC3), mRNA
GGTCTCTTTGGGTGGCCCGTGCCTGCTCGGTTCCTGCTGTGACCTCTCTCAAGATGCCCGAGCCAGGGAA
GAAACCAGTCTCCGCCTTCAGCAAGAAGCCACGGTCCGCAGAGGTGGCCGCCGGCAGCTCTGCTGTGTTC
GAGGCCGAGACAGAGCGGGCAGGACTGAAGGTGCGCTGGCAGCGGGCGGGCAGCGACATCAGTGCCAGCG
ACAAATACAGCCTGGCAGCCGAGGGCACGCGGCACACGCTGACCGTGCGGGATGTGGGTCCCGCCGACCA
GGGCTCCTACGCGGTCATCGCTGGCTCCTCCAAGGTCAAGTTTGACCTCAAGGTTGTAGACGCAGGGAAA
GCGGAGCCTGTGTCAGCCCCTGCTCCCGCCCCCACCGAGGCCCCTGGAGCCCCGGGAGAGGCCCCGACCT
CTGCCCCTGAGGTGGAAGCAGGCGCCCCCAGTCCCGAAGAGTCCAGCTCAGCGGCCCCTGAGGGCCCCAG
TGCCCCTGGCGACCCCATCGGCCTCTTTGTGATGAGGCCACAGGACGGCGAGGTGACCGTGGGTGGCACC
ATCACCTTCTCAGCCCGCGTGGCCGGAGCCAGCCTCTTGAAACCGCCCGTAGTCAAGTGGTTCAAGGGCA
AGTGGGTGGACCTGAGCAGCAAGGTGGGGCAGCATCTGCAGCTGCACGACAGCTACGATCGGACCAGCAA
GGTCTACCTGTTTGAGCTGCGCATCATGGATGCCCAGACCACCTTTGCCGGCGGTTACCGCTGTGAGGTG
TCCACCAAGGACAAATTTGACAGCTGCAACTTCAACCTCACTGTCCATGAGGCCGTTGGCCCTGGAGATG
TGGACCTCCGATCAACTTTCCGCCGCACGAGCCTGGCTGGAGGCAGTCGGCGCATCAGCGACAGCCATGA
AGACGCTGGGACTCTGGACTTCAGCTCGCTGCTGAGGAAGAGCAGTTTACGGACCCCGAGGCTGGAGGCC
CCCGCCGAGGAGGACGTGTGGGAGATCCTGCGGCAGGCACCCCCGTCGGAGTACGAGCGCATCGCCTTCC
![Page 10: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/10.jpg)
![Page 11: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/11.jpg)
![Page 12: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/12.jpg)
![Page 13: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/13.jpg)
![Page 14: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/14.jpg)
![Page 15: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/15.jpg)
toda filogenia es en esencia una hipótesis
![Page 16: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/16.jpg)
Una serie de supuestos
Que podemos reconstruir la historia
Contamos con un marcador adecuado
Son ortólogos, tasa similar
Están bien alineadas
Usamos el método adecuado
![Page 17: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/17.jpg)
Purpose of phylogenetics :
Try to find the genealogical ties between organisms, reconstructing the evolutionary relationship between species.
Backtrack characterizations of ancestors
Estimate the time of divergence between two organisms since they last shared a common ancestor.
![Page 18: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/18.jpg)
a) las relaciones de ancestría y
descendencia (la topología del
árbol)
b) la longitud de las ramas que
conectan a los OTUs,
c) la posición de la raíz (el nodo
hipotético más antiguo)
Inferencia filogenética y evolución molecular
![Page 19: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/19.jpg)
Árboles filogenéticos
![Page 20: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/20.jpg)
un mismo árbol se puede dibujar de distintas formas
![Page 21: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/21.jpg)
![Page 22: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/22.jpg)
La raíz de un árbol
Un árbol con raíz es un árbol polarizado. Es decir, un árbol en donde conocemos la
dirección de los cambios (cuales linajes divergieron primero y cuales posteriormente)
![Page 23: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/23.jpg)
Para el número de árboles bifurcantes sin raíz (NU) para n OTUs (n ³ 3) la relación
está dado por (Li, 1997):
Mientras que el número de árboles bifurcantes con raíz (NR) para n OTUs (n ³ 2)
está dado por (Li, 1997):
![Page 24: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/24.jpg)
![Page 25: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/25.jpg)
Los métodos
![Page 26: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/26.jpg)
Tipos de métodos
• De agrupación y de búsqueda
• Fenéticos, Cladistas, probabilidad
![Page 27: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/27.jpg)
Por el tipo de datos
![Page 28: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/28.jpg)
Modelos de evolución de sustitución de nucleótidos
I. Frecuencias de nt : πA = πC = πG = πT = 0.25 ó πA ≠ πC ≠ πG ≠ πT
. modelos de = frecuencia: JC69; K2P, K3P ...
. modelos de ≠ frecuencia: F81, F84, HKY85, TrN93, GTR
II. Tasas de sustitución transicionales/transversionales
tasas modelo
1 JC69 (ti=tv)
2 K2P, F84 (ti ≠tv)
3 TrN ó K3P (2 ti, 1 tv)
6 GTR (cada sust. su tasa)
![Page 29: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/29.jpg)
Modelos básicos de evolución de DNA
![Page 30: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/30.jpg)
Alineacion multiple
![Page 31: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/31.jpg)
Métodos de distancia
![Page 32: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/32.jpg)
Unweighted Pair-Group Meted with Arithmetic Mean (UPGMA)
dAB /2A
B
Supongamos que dAB tienen el menor valor. Entonces, los OTUs
A y B se agrupan y se coloca un punto de ramificación a una
distancia de dAB /2 sustituciones
![Page 33: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/33.jpg)
Unweighted Pair-Group Meted with Arithmetic Mean (UPGMA)
dAB /2A
B
Supongamos que dAB tienen el menor valor. Entonces, los OTUs
A y B se agrupan y se coloca un punto de ramificación a una
distancia de dAB /2 sustituciones
![Page 34: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/34.jpg)
Después del agrupamiento, A y B se tratan como un solo OTU
compuesto y se computan las distancias nuevamente
UPGMA
![Page 35: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/35.jpg)
Después del agrupamiento, A y B se tratan como un solo OTU
compuesto y se computan las distancias nuevamente
UPGMA
Si d(AB)C resulta ser la distancia más pequeña,
![Page 36: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/36.jpg)
entonces el OTU C se une al OTU compuesto (AB) y se coloca un
nodo en d(AB)C /2
A
B
UPGMA
A
B
C
![Page 37: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/37.jpg)
A
B
C
El último paso consiste en agrupar el último OTU, D, al OTU
compuesto (ABC). La raíz del árbol entero se coloca en:
A
B
A
B
C
UPGMA
![Page 38: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/38.jpg)
la distancia entre dos OTUs compuestos se computa como la media
aritmética de las distancias pareadas entre los OTUs que los
constituyen.
Por ejemplo, la distancia entre los OTUs compuestos (ij) y (mn) es:
En UPGMA,
![Page 39: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/39.jpg)
UPGMA funciona,
• Si los datos son ultramétricos
• Si la tasa de sustituciones es idéntica
Además,
• El promedio carece de sentido biológico
• Es el peor método para inferir filogenias
![Page 40: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/40.jpg)
Neighbour joining
Método fue propuesto en 1987 por Saitou y Masatoshi Nei, que
produce la unión de los OTU's más cercanos (vecinos) tratando de
minimizar la longitud total del árbol.
![Page 41: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/41.jpg)
Los nodos 1 y 2 son los mas cercanos, pero 1 y 3 son los vecinos
Distancia y vecindad
![Page 42: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/42.jpg)
Neighbour joining
Se calcula la divergencia de la red para cada OTU, denominada
con la letra r:
![Page 43: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/43.jpg)
Se calcula la nueva matriz de distancias con la siguiente formula:
![Page 44: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/44.jpg)
Se selecciona el vecino mas cercano e iniciamos de nuevo
La raíz se
coloca ala mitad
del grupo
externo
![Page 45: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/45.jpg)
• Es el método mas rápido
• Resuelve datos masivos
• Análisis masivo de secuencias
• En biología similitud no es igual a
homología
![Page 46: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/46.jpg)
Máxima parsimonia
El método de máxima parsimonia se basa en la
suposición de que la filogenia más probable es
aquella que requiere en menor número de cambios.
![Page 47: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/47.jpg)
Métodos probabilísticos
• Maxima verosimilitud (Maximum Likelihood)
• Bayesianos
• Modelos de Marcov
• Muy buenos para pocos OTUs
![Page 48: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/48.jpg)
![Page 49: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/49.jpg)
![Page 50: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/50.jpg)
Bootstrap
![Page 51: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/51.jpg)
A/Indiana/09/2009 | EPI ISL 29954 | GQ11
A/Mexico/4486/2009 | EPI ISL 29711 | 200
A/California/05/2009 | EPI ISL 29575 | F
A/California/06/2009 | EPI ISL 29576 | F
A/Mexico/4108/2009 | EPI ISL 29731 | 200
A/Arizona/02/2009 | EPI ISL 29959 | GQ11
A/South Carolina/09/2009 | EPI ISL 29958
EPI178507 | HA | A/England/195/2009 | EP
A/Texas/15/2009 | EPI ISL 29990 | 200971
A/Kansas/02/2009 | EPI ISL 29960 | GQ117
A/California/04/2009 | EPI ISL 29573 | F
A/Texas/06/2009 | EPI ISL 29746 | FJ9843
A/Mexico/InDRE4114/2009
A/Texas/08/2009 | EPI ISL 29951 | GQ1170
A/Texas/09/2009 | EPI ISL 29952 | GQ1170
A/Arizona/01/2009 | EPI ISL 29955 | GQ11
A/Texas/04/2009 | EPI ISL 29715 | FJ9816
A/Mexico/InDRE4487/2009 | EPI ISL 29924
A/Mexico/4604/2009 | EPI ISL 29617 | 200
A/Michigan/02/2009 | EPI ISL 29956 | GQ1
A/Mexico/4603/2009 | EPI ISL 29734 | 200
A/Massachusetts/07/2009 | EPI ISL 29966
A/New York/10/2009 | EPI ISL 29738 | FJ9
A/New York/18/2009 | EPI ISL 29742 | FJ9
A/Massachusetts/06/2009 | EPI ISL 29965
A/New York/31/2009 | EPI ISL 29745 | FJ9
A/New York/13/2009 | EPI ISL 29963 | GQ1
A/New York/23/2009 | EPI ISL 29744 | FJ9
A/Canada-ON/RV1527/2009 | EPI ISL 29923
A/California/14/2009 | EPI ISL 29953 | G
A/New York/22/2009 | EPI ISL 29949 | GQ1
A/New York/20/2009 | EPI ISL 29948 | GQ1
A/New York/19/2009 | EPI ISL 29743 | FJ9
A/Ohio/07/2009 | EPI ISL 29962 | GQ11710
A/New York/11/2009 | EPI ISL 29739 | FJ9
A/Mexico/4486/2009
A/California/06/2009
A/England/195/2009
A/Mexico/InDRE4487/2009
A/Texas/09/2009
A/California/04/2009
A/Mexico/4604/2009
A/New York/18/2009
A/Canada-ON/RV1527/2009
A/California/14/2009
NJ del concatenado de HA-NA-NP(500 bootstraps, colapsado a 50 o menos )
NJ del concatenado de todos los genes(500 bootstraps, colapsado a 50 o menos )
![Page 52: Filogenias moleculares (los métodos) - ccg.unam.mxvinuesa/tlem/docs/filogenias-CCG-7.pdf · All living things have much in common, in their chemical composition, their germinal vesicles,](https://reader031.vdocumento.com/reader031/viewer/2022022617/5ba9543609d3f24c398c7202/html5/thumbnails/52.jpg)