![Page 1: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/1.jpg)
ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda condicionat a lʼacceptació de les condicions dʼúsestablertes per la següent llicència Creative Commons: http://cat.creativecommons.org/?page_id=184
ADVERTENCIA. El acceso a los contenidos de esta tesis queda condicionado a la aceptación de las condiciones de usoestablecidas por la siguiente licencia Creative Commons: http://es.creativecommons.org/blog/licencias/
WARNING. The access to the contents of this doctoral thesis it is limited to the acceptance of the use conditions setby the following Creative Commons license: https://creativecommons.org/licenses/?lang=en
![Page 2: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/2.jpg)
School of Engineering
Department of Chemical, Biological and Environmental Engineering
AUTOTROPHIC BIOLOGICAL NITROGEN
REMOVAL IN A TWO-STAGE SYSTEM AT
MAINSTREAM CONDITIONS
PhD Thesis
in Environmental Science and Technology
Supervised by:
Dr. Julián Carrera Muyo
Clara Reino Sánchez
Bellaterra, September 2016
![Page 3: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/3.jpg)
©Clara Reino Sánchez, 2016
Autotrophic biological nitrogen removal in a two-stage system at mainstream conditions
No part of this thesis may be reproduced, stored in a retrieval system of any nature, or
transmitted in any means, without permission of the author, or when appropriate, of the
publishers of the publications.
![Page 4: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/4.jpg)
Title: Autotrophic Biological Nitrogen Removal In A Two-Stage
System At Mainstream Conditions
Presented by: Clara Reino Sánchez
Supervisors: Julián Carrera Muyo
Doctoral Programme in Environmental Science and Technology,
specialty in Environmental Technology.
ICTA – Institut de Ciència i Tecnologia Ambientals.
Departament d’Enginyeria Química Biològica i Ambiental.
Escola d’Enginyeria.
Universitat Autònoma de Barcelona, Bellaterra.
Part of this work has been done at the Delft University of Technology (Delft, The
Netherlands) under the supervision of Dr. J. Pérez Cañestro and Prof.Dr. M. C. M. van
Loosdrecht.
![Page 5: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/5.jpg)
![Page 6: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/6.jpg)
![Page 7: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/7.jpg)
![Page 8: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/8.jpg)
A Vito, Naso e Ana.
![Page 9: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/9.jpg)
![Page 10: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/10.jpg)
i
CONTENTS
Summary ……………………………………………………………………….…..………..vii
Resumen ………………………………………………………………………………..….…ix
List of Acronyms, Abbreviations and Symbols …………………………………………....xi
CHAPTER 1. MOTIVATIONS AND THESIS OVERVIEW
1.1. Motivations ……………………………………………………………………….3
1.2. Thesis overview …………………………………………………………………..3
CHAPTER 2. GENERAL INTRODUCTION
2.1. The need of wastewater treatment ………………………………….………..…...7
2.2. Nitrogen removal in urban wastewater treatment plant .…………...…………......8
2.2.1. From activated sludge systems to the potential implementation of anammox in the mainstream
2.2.2. Implementation of anammox-based technologies for nitrogen removal in urban WWTPs: from sidestream to mainstream
2.3. The future of urban WWTPs ……………………..…………….………..…........16
CHAPTER 3. OBJECTIVES OF THE THESIS
Objectives of the thesis ...……………………………………..…………….………..…........21
CHAPTER 4. GENERAL MATERIALS AND METHODS
4.1. Description of the reactors and experimental set-up …………………….……...25
4.1.1. Lab-scale airlift reactor
4.2.2. Lab-scale UASB reactor
4.2. Analytical methods ……………………………………………………………...27
4.2.1. Analysis of nitrogen species: ammonium, nitrite and nitrate
4.2.2. Chemical oxygen demand
4.2.3. Settling properties
![Page 11: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/11.jpg)
ii
4.2.4. Total and volatile solids concentrations
4.3. Microbial analysis ……………………………………….………………………28
4.3.1. Fluorescence in situ hybridization
4.3.2. Pyrosequencing analysis
CHAPTER 5. KINETIC AND MICROBIOLOGICAL CHARACTERIZATION OF AEROBIC GRANULES PERFORMING PARTIAL NITRITATION OF A LOW-STRENGTH WASTEWATER AT 10 °C
Abstract………………………………………………………………..…………….…3
5.1. Introduction …………………………………………………………….……….37
5.2. Materials and Methods ……………..……………………………………...……38
5.2.1. Reactor set-up and operation
5.2.2. Inoculum and influent characteristics
5.2.3. Kinetic experiments
5.2.4. Fluorescence in situ hybridization
5.2.5. Pyrosequencing
5.2.6. Scanning electron microscopy
5.2.7. Specific analytical methods
5.3. Results and discussion ………………………………………………......……...43
5.3.1. Long-term operation at 10 °C
5.3.2. Kinetics
5.3.3. Microbial characterization
5.4. Conclusions ………………………………………………………………...…...57
CHAPTER 6. EFFECT OF TEMPERATURE ON N2O PRODUCTION FROM A HIGHLY ENRICHED NITRIFYING GRANULAR SLUDGE PERFORMING PARTIAL NITRITATION AT MAINSTREAM CONDITIONS
Abstract ………………………………………………...………………………….…61
6.1. Introduction …………………………………………………………...…………63
6.2. Materials and Methods …………………………………………………………..65
6.2.1. Configuration and operation phases of the reactor
6.2.2. Inoculum and influent characteristics
![Page 12: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/12.jpg)
iii
6.2.3. Specific analytical methods and N2O measurements
6.2.4. Calculation of the N2O production factors
6.2.4.1. Calculation of the N2O liquid concentration
6.2.5. Fluorescence in situ hybridization
6.3. Results and discussion ………………………………………………………..…71
6.3.1. Operation of the reactor
6.3.2. Microbial characterization of the granular sludge
6.3.3. Nitrous oxide production
6.4. Conclusions ……………………………………………………..……………….83
CHAPTER 7. DEVELOPMENT OF NITRATATION ACTIVITY AFTER THE LONG-TERM STABLE PARTIAL NITRITATION OF A LOW-STRENGTH WASTEWATER IN A GRANULAR AIRLIFT REACTOR
Abstract ………………………..……………………………………………………..87
7.1.Introduction ………………………………………………………………………89
7.2. Materials and Methods ……………….………………………………………….91
7.2.1. Reactor set-up and operation
7.2.2. Inoculum and influent characteristics
7.2.3. Anammox activity batch test
7.2.4. Fluorescence in situ hybridization
7.2.5. Specific analytical methods and calculations
7.3. Results and discussion ..…………………………………………………………93
7.3.1. Reactor operation
7.3.2. Development of the nitratation activity
7.3.2.1. Effect of solid retention time
7.3.2.2. Growth of anammox bacteria
7.3.3. Microbial characterization
7.3.4. Development of an enriched NOB biofilm in the riser of the airlift reactor
7.4. Practical Implications …………..………………………………………………107
7.5. Conclusions …………………………………………………………………….108
![Page 13: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/13.jpg)
iv
CHAPTER 8. LOW-STRENGTH WASTEWATER TREATMENT IN AN ANAMMOX UASB REACTOR: EFFECT OF THE LIQUID UPFLOW VELOCITY
Abstract ……………………………………………………………………………..111
8.1. Introduction ……….……………………………………………………………113
8.2. Materials and Methods …………………………………………………………115
8.2.1. Reactor, experimental set-up and operation
8.2.2. Inoculum and synthetic wastewater
8.2.3. Calculations
8.2.4. Fluorescence in situ hybridization
8.2.5. Specific analytical methods
8.3. Results and discussion …………………………………………………………119
8.3.1. Operation of the UAnSB reactor
8.3.2. Effect of the liquid upflow velocity on the operation of the UAnSB reactor
8.3.2.1. Granualation
8.3.2.2. External mass transfer limitations
8.4. Conclusions …………….………………………………………………………130
CHAPTER 9. STABLE LONG-TERM OPERATION OF AN ANAMMOX UASB REACTOR AT MAINSTREAM CONDITIONS
Abstract ……………………………………………………………………………..133
9.1. Introduction …………………………………………………………………….135
9.2. Materials and Methods …………………………………………………………136
9.2.1. Reactor set-up and operation
9.2.2. Inoculum and wastewater characteristics
9.2.3. Maximum specific heterotrophic activity
9.2.4. Inorganic elements analysis
9.2.5. Calculations
9.2.6. Fluorescence in situ hybridization
9.2.7. Pyrosequencing
9.2.8. Specific analytical methods
9.3. Results ………….………………………………………………………………141
![Page 14: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/14.jpg)
v
9.3.1. Operation of the UAnSB reactor at low temperatures
9.3.2. Physicochemical characterization of the sludge bed
9.3.3. Microbial characterization of the sludge bed
9.4. Discussion ………………………………………………………………...……154
9.4.1. Effect of low temperature on the anammox activity
9.4.2. Effect of the real urban wastewater on the anammox activity
9.5. Conclusions ……………..………………………………………………...……162
CHAPTER 10. GENERAL CONCLUSIONS.
General conclusions ……………………...…………………………………………………165
CHAPTER 11. REFERENCES.
References …………………………………………………………………………………..169
Annex I ……………………………………………………………………………………..187
Annex II……………………………………………………………………………….……197
![Page 15: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/15.jpg)
vi
![Page 16: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/16.jpg)
vii
SUMMARY
Urban wastewater treatment plants (WWTPs) are widely implemented over the
industrialized world since urban wastewater treatment is needed before the discharge of the
wastewater into the environment. In conventional activated sludge systems, nitrogen
compounds are biologically removed through autotrophic nitrification and heterotrophic
denitrification with a good effluent quality. Nevertheless, such treatment requires a lot of
energy due to the aeration needed for nitrification and uses most of the organic matter for
denitrification instead of producing biogas. For achieving an energy-neutral or even energy-
positive urban WWTP the implementation of autotrophic biological nitrogen removal (BNR)
in the mainstream has been proposed. Hence, the urban wastewater treatment would consist of
a first step (A-Stage), where all the organic matter is removed and derived to biogas
production, and a second step (B-Stage), where the nitrogen is removed through the
autotrophic BNR process.
Autotrophic BNR is a two-step process. First, half of the ammonium contained in the
wastewater is oxidized to nitrite under aerobic conditions in a process called partial nitritation
(PN); and secondly, the rest of the ammonium and nitrite generated are converted to
dinitrogen gas through the anammox process without the need of oxygen and organic matter.
Autotrophic BNR has been successfully applied for treating some industrial wastewaters and
reject water from digested sludge (high-strength and warm wastewaters). However, it has
never been applied in the mainstream of an urban WWTP (low-strength and cold wastewater)
since mainstream conditions are more disadvantageous for the process. So far researchers
have focused on implementing the autotrophic BNR in one-stage systems, where the whole
process takes place in one single reactor. However, in most cases PN fails in the long-term
operation and destabilization of the anammox process eventually occurs; even those systems
which succeed on achieving stable operation showed low nitrogen conversion rates.
Here, a two-stage system is proposed as an alternative for a better implementation of
autotrophic BNR in the mainstream of an urban WWTP. Thus, the thesis aimed at
demonstrating the stability of PN and anammox processes in two separated reactors treating
wastewater at mainstream conditions.
Firstly, a granular sludge airlift reactor performing the PN process was successfully
operated in continuous mode. A synthetic influent mimicking the effluent of the A-Stage was
treated at temperatures as low as 10 °C. Not only stable operation was achieved in the long-
![Page 17: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/17.jpg)
viii
term operation, but also high nitrification rates and a suitable effluent for a subsequent
anammox reactor. Moreover, N2O gas emissions were determined in the reactor and,
furthermore, a medium-term study to assess the temperature effect on the N2O emissions
associated to the PN process was performed.
Secondly, an Upflow Anaerobic Sludge Blanket (UASB) reactor performing the
anammox process was successfully operated in continuous mode at mainstream conditions.
On one hand, the feasibility of using an UASB reactor to implement the anammox process at
mainstream conditions was demonstrated by achieving high nitrogen removal rates and high
nitrogen removal efficiencies at 26 °C treating a synthetic influent. In addition, an in depth
study of the effect of the upflow velocity on the performance of the anammox UASB reactor
was done. Furthermore, an exhaustive study of the effect of decreasing temperature on
anammox activity was performed and an adaptation of anammox bacteria after long-term
operation at low temperatures was observed. On the other hand, a successful long-term
operation of the anammox reactor treating a real urban wastewater was achieved at high
nitrogen removal rates and a temperature as low as 11 °C.
Moreover, a detailed study of the biomass developed in the above-mentioned reactors
from the microbiological, kinetic and physicochemical points of view, was performed aiming
at correlating such characteristics to the reactor’s operation at mainstream conditions.
![Page 18: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/18.jpg)
ix
RESUMEN
Actualmente las estaciones depuradoras de aguas residuales (EDAR) urbanas están
ampliamente implantadas en los países industrializados, puesto que es necesario realizar un
tratamiento de las aguas residuales antes de verterlas al medioambiente. En los sistemas de
tratamiento convencionales, los compuestos nitrogenados se eliminan mediante un
tratamiento biológico de nitrificación autotrófica y desnitrificación heterotrófica, que
garantiza una buena calidad del efluente. En estos tratamientos se necesita gran cantidad de
aireación para la nitrificación y la mayoría de la materia orgánica del agua residual se destina
a la desnitrificación en lugar de a la producción de biogás. Por tanto, las EDAR urbanas
presentan un gran consumo energético y el principal reto en la actualidad es conseguir una
depuradora urbana autosuficiente energéticamente. Una alternativa para conseguirlo es la
implementación de la eliminación biológica autotrófica de nitrógeno (BNR) en la línea
principal de aguas. El tratamiento consistiría en una primera etapa (A-Stage) en la cual se
eliminaría toda la materia orgánica destinándola a la producción de biogás, y una segunda
etapa (B-Stage) en la que se eliminaría el nitrógeno mediante el proceso BNR.
El proceso BNR es un proceso en dos etapas. Primero, la mitad del amonio presente
en el agua residual se oxida a nitrito mediante el proceso de nitritación parcial (PN), y a
continuación el amonio restante y el nitrito generado se convierten en N2 mediante el proceso
anammox, sin necesidad de oxígeno ni materia orgánica. El proceso BNR se ha aplicado al
tratamiento de aguas con altas cargas de nitrógeno y temperaturas cálidas, pero nunca se ha
implementado en el tratamiento de aguas residuales urbanas (bajas cargas y temperaturas).
Recientemente, la investigación se ha centrado en el desarrollo del proceso BNR en un único
reactor. Sin embargo, muchos de los estudios publicados mostraron el fallo del proceso PN en
la operación a largo plazo al tratar agua urbana, e incluso aquellos sistemas con una operación
estable alcanzaron bajas velocidades de eliminación de nitrógeno.
En esta tesis se propuso la utilización de un sistema en dos etapas como alternativa
para una mejor implementación del proceso BNR en la línea principal de aguas de una EDAR
urbana. Así, el principal objetivo fue demostrar la estabilidad de los dos procesos implicados,
PN y anammox, en dos reactores independientes tratando un agua residual urbana.
En primer lugar se operó en continuo un reactor airlift con biomasa granular tratando
un influente sintético que simulaba el efluente de la etapa A-Stage. Se trabajó a bajas
temperaturas (hasta los 10 °C) y no solo se consiguió una operación estable a largo plazo sino
![Page 19: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/19.jpg)
x
que se obtuvieron altas velocidades de nitrificación y un efluente adecuado para un reactor
anammox contiguo. Además, se determinaron las emisiones de N2O producidas en el reactor
y se realizó un estudio del efecto de la temperatura sobre éstas.
En segundo lugar se operó en continuo un reactor UASB (Upflow Anaerobic Sludge
Blanket) realizando el proceso anammox a largo plazo. Por una parte, se presentó el reactor
UASB como una buena alternativa para realizar el proceso anammox en la línea principal de
aguas de la depuradora. Además se realizó un estudio exhaustivo del efecto de la velocidad
ascensional en el reactor y del efecto de la baja temperatura en la actividad anammox. Por otra
parte, el reactor UASB anammox no sólo mostró una operación estable a largo plazo tratando
un agua residual urbana real, sino que también se alcanzaron altas velocidades de eliminación
de nitrógeno a una temperatura de 11 °C.
Conjuntamente, se realizó un estudio detallado de la biomasa desarrollada en ambos
reactores desde los puntos de vista microbiológico, cinético y físico-químico, con el objetivo
de relacionar estas características con la operación.
![Page 20: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/20.jpg)
xi
LIST OF ACRONYMS AND ABBREVIATIONS
A Cross-sectional area of the reactor
AMO Ammonia monooxygenase
Anammox Anaerobic ammonium-oxidizing
AOB Ammonia Oxidizing Bacteria
AOR Ammonium Oxidation Rate
BLAST Basic Local Alignment Search Tool
BNR Biological Nitrogen Removal
C Carbon
CANON Completely Autotrophic Nitrogen removal Over Nitrite
CAS Conventional Activated Sludge
CLSM Confocal Laser Scanning Microscopy
COD Chemical Oxygen Demand
DF Diffusional coefficient
dg Granule diameter
DNA Deoxyribonucleic Acid
DO Dissolved Oxygen
Ea Activation energy
EFgas Gas emission factor
EPS Extracellular Polymeric Substances
EU European Union
EGSB Expanded Granular Sludge Bed
FISH Fluorescence in situ hybridization
GHG Greenhouse Gas
HAO Hydroxylamine oxidoreductase
H-MBBR Hybrid Moving Bed Biofilm Reactor
![Page 21: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/21.jpg)
xii
HRT Hydraulic Retention Time
IFAS Integrated Fixed film Activated Sludge
kc External mass transfer coefficient
kLa Mass transfer coefficient
KS,TAN TAN affinity constant
LL External boundary layer
MBBR Moving Bed Biofilm Reactor
N Nitrogen
N/D Nitrification/Denitrification
NLR Nitrogen Loading Rate
NOB Nitrite Oxidizing Bacteria
NRR Nitrogen Removal Rate
OLAND Oxygen-Limited Autotrophic Nitrification/Denitrification
OTU Operational Taxonomic Unit
OUR Oxygen Uptake Rate
PBS Phosphate Buffered Saline
PFliq Liquid production factor
PFtot Total production factor
PN/A Partial Nitritation and Anammox
Q Flow rate
RBC Rotating Biological Contactor
Re Non-dimensional Reynolds number
rRNA Ribosomal Ribonucleic Acid
sAOR Specific Ammonium Oxidation Rate
SAA Specific Anammox Activity
SBR Sequential Batch Reactor
Sc Non-dimensional Schmidt number
![Page 22: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/22.jpg)
xiii
Sh Non-dimensional Sherwood number
SHARON Single reactor High activity Ammonia Removal Over Nitrite
SMP Soluble Microbial Products
sNLR Specific Nitrogen Loading Rate
SRT Solids Retention Time
SVI Sludge Volumetric Index
T Temperature
TAN Total Ammonia Nitrogen
TNN Total Nitrite Nitrogen
TS Total Solids
TSS Total Suspended Solids
UASB Upflow Anaerobic Sludge Blanket
UAnSB Upflow Anammox Sludge Blanket
UMABR Upflow Membrane-Aerated Biofilm Reactor
V Volume
VS Volatile Solids
VSS Volatile Suspended Solids
Vup Upflow velocity
WWTP Wastewater Treatment Plant
GREEK SYMBOLS
ρw Density of water
µ Specific growth rate
µmax Maximum specific growth rate
µw Viscosity of water
θ Temperature coefficient
![Page 23: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/23.jpg)
xiv
![Page 24: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/24.jpg)
Chapter 1
MOTIVATIONS AND THESIS OVERVIEW
![Page 25: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/25.jpg)
Chapter 1. Motivations and Thesis Overview
2
![Page 26: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/26.jpg)
Chapter 1. Motivations and Thesis Overview
3
1.1. MOTIVATIONS
Since last century, urban wastewater treatment plants (WWTPs) were widely
implanted all over the industrialized world and all developments were aimed at improving the
quality of water. Therefore, nowadays a good effluent quality is guaranteed in the developed
countries and the new challenge is to achieve an advanced and sustainable urban WWTP.
Since urban wastewater treatment plants are very energy-demanding facilities, one of the
main challenges to face is the achievement of an energetic self-sufficient urban WWTP, with
an improved energy balance and more efficient control strategies and operational procedures,
as pointed out by the WATER 2020 EU project in the frame of the EU project HORIZON
2020. Several theoretical studies have revealed that the only way of reducing the costs of
operation of an urban WWTP, and even to turn it into a producing energy facility, is
implementing the autotrophic Biological Nitrogen Removal (BNR) in the main water line
(Kartal et al., 2010; Verstraete and Vlaeminck, 2011). As in any process, before the
implementation at real-scale, an extensive labour of research is needed at smaller scale such
as lab-scale and pilot scale. Thus, this thesis is focused on achieving a stable operation at lab-
scale of the process comprising the autotrophic BNR (i.e. partial nitritation and anammox
process) at mainstream conditions.
1.2. THESIS OVERVIEW
In the present chapter (Chapter 1) the motivations of this thesis and the thesis
overview are presented. In Chapter 2 a brief introduction of the topic is presented, focused on
the urban wastewater treatments already implemented in urban WWTPs and the future
perspectives of the wastewater treatment field. Chapter 3 states the main objectives of the
thesis. Chapter 4 describes the general materials and methods used during the experimental
work of this thesis which were common to all the experiments presented in the chapters of
results; thus, the more specific materials and methods used in specific chapters are described
in the corresponding chapter where they were used. Chapters 5 to 9 contain the results
obtained during the development of the thesis.
Chapter 5, 6 and 7 comprise the results obtained for the partial nitritation reactor.
More specifically Chapter 5 describes the successful long-term operation at low temperature
and mainstream conditions; Chapter 6 is focused on the determination of nitrous oxide
![Page 27: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/27.jpg)
Chapter 1. Motivations and Thesis Overview
4
emissions of the partial nitritation process at mainstream conditions; and Chapter 7 deals with
the destabilization of the nitritation process after a long-term stable operation.
Chapters 8 and 9 comprise the results obtained for the anammox reactor. More
specifically, Chapter 8 describes the start-up of the anammox reactor in an Upflow Anaerobic
Sludge Blanket (UASB) reactor and a complete study of the granulation and implementation
of anammox process in UASB reactors; and Chapter 9 describes the successful long-term
operation of the UASB anammox reactor at mainstream conditions.
Chapter 10 states the main conclusions extracted from this thesis and, finally, Chapter
11 presents all the references used during this writing.
![Page 28: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/28.jpg)
Chapter 2
GENERAL INTRODUCTION
![Page 29: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/29.jpg)
Chapter 2. General Introduction
6
![Page 30: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/30.jpg)
Chapter 2. General Introduction
7
2.1. THE NEED OF WASTEWATER TREATMENT
The industrialization, increasing urbanization, modern life standards and irrigation
degree led to a huge wastewater production in the developed countries (25–150 m3 p-1 year-1
in EU countries in 2011, Eurostat 2015), which brought up the need of a wastewater treatment
before the discharge into the environment. Urban wastewater is characterized for presenting
anthropogenic origin, low levels of pollutants (more commonly organic matter, nitrogen and
phosphorous) and low heat energy content. Overall, urban wastewater is transported to a
wastewater facility, where it is treated in an energy-demanding dissipative way before being
returned to a natural system (Verstraete and Siegfried, 2011).
Since its presentation at the beginning of last century (Ardern and Lockett, 1914), the
conventional activated sludge (CAS) system continues being the most commonly used
technology for urban wastewater treatment, although significant improvements have been
developed since the first version of CAS system was implemented. Activated sludge is a
mixture of inert solids combined with a microbial population growing on the biodegradable
substrates present in the sewage (van Loosdrecht and Brdjanovic, 2014). CAS system allows
the conversion of roughly half of the chemical oxygen demand (COD) of wastewater into
sludge and the other half to CO2, and the resulted water can be decanted and discharged into
the environment (Verstraete and Siegfried, 2011).
Most current urban wastewater treatment plants (WWTPs) only treat organic matter
through CAS system, however during the past several decades nutrients as nitrogen and
phosphorous became an important concern since can be toxic to aquatic life and cause
eutrophication and oxygen depletion in water streams. Actually, nutrients pollution has
impacted many streams, rivers, lakes, bays and coastal waters resulting in serious
environmental and human health issues, and impacting the economy (EPA Website, 2016).
Thus, in the most developed countries, CAS systems have incorporated the biological
nutrients removal through nitrification/denitrification and enhanced phosphorous removal.
![Page 31: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/31.jpg)
Chapter 2. General Introduction
8
2.2. NITROGEN REMOVAL IN URBAN WASTEWATER TREATMENT PLANTS
2.2.1. From activated sludge systems to the potential implementation of
anammox in the mainstream
In the current CAS systems with nitrogen removal incorporated, nitrogenous
compounds are removed by biological treatment through bacterial nitrification/denitrification
(N/D). First, nitrification takes place under aerobic conditions; ammonia is oxidized to nitrite
by ammonia oxidizing bacteria (AOB) and nitrite is oxidized to nitrate by nitrite oxidizing
bacteria (NOB). Then, denitrification occurs under anoxic conditions where nitrite and nitrate
are reduced by heterotrophic bacteria to nitrogen gas (N2).
The main advantage of this conventional treatment is that guarantees a good effluent
quality with a relative easy implementation, however it presents high operational costs and
needs a high land availability. The major costs associated to CAS systems with biological
N/D implemented are related to the energy consumption and sludge treatment. The aeration
energy consumption for organic matter removal and nitrification is about 60–80% of the total
energy consumption of an urban WWTP (Siegrist et al., 2008; Zessner et al., 2010); and up to
40% of the operational costs are associated to the sludge treatment and disposal (Verstraete
and Siegfried, 2011). Thus, nowadays, urban WWTPs are very energy-demanding facilities
and achieving an advanced and sustainable WWTP is the challenge to face by the modern
society.
Some urban WWTPs incorporate the anaerobic digestion of the primary and secondary
sludge produced during the CAS treatment in order to recover energy as biogas, however the
energy recovery only achieves values up to 50% in the most energy-efficient plants
(Verstraete and Siegfried, 2011). This is due to that a significant part of the organic matter
present in the wastewater is used for denitrification instead of being used for producing biogas
and, thus, only primary and secondary sludge can be destined to anaerobic digestion. If the
organic matter removal and nitrogen removal processes were independent treatments, all the
organic matter present in the raw wastewater could be redirected to the anaerobic digestion
process and the subsequent energy recovery through biogas could be increased.
The finding of anaerobic ammonium-oxidizing (anammox) bacteria (Mulder et al.,
1995) brought up the possibility of separating the organic matter and nitrogen removal
processes. Anammox bacteria are chemolithoautotrophic microorganisms which grow by the
oxidation of ammonium coupled to nitrite reduction, using CO2 as the sole carbon source and
![Page 32: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/32.jpg)
Chapter 2. General Introduction
9
hence do not require organic carbon (Kartal et al., 2013). The appearance of anammox
bacteria guaranteed the possibility of performing an autotrophic denitrification in urban
WWTPs; and thus, the autotrophic biological nitrogen removal (BNR) via nitritation-
autotrophic denitrification appeared as an alternative to the conventional BNR via autotrophic
nitrification-heterotrophic denitrification. Autotrophic BNR is a two-step process. Firstly, half
of the supplied ammonium is oxidized to nitrite (partial nitritation) by AOB under aerobic
conditions; and secondly, ammonium and nitrite are directly converted to N2 by the anammox
bacteria without oxygen and organic matter consumption.
The implementation of the autotrophic BNR has been proposed for achieving an
energy-neutral or even energy-positive urban WWTP (Kartal et al., 2010; Siegrist et al.,
2008). As depicted in Fig. 2.1, the wastewater treatment would consist of a first step (A-
Stage) where all the organic matter is removed and derived to biogas production, and a second
step (B-Stage) where the nitrogen is removed through the autotrophic BNR process. Several
technologies have been proposed for performing the A-Stage, such as the use of anaerobic
digestion (Gao et al., 2014, 2015) or the use of a high-rate activated sludge system (Ge et al.,
2013; Jimenez et al., 2015).
Fig. 2.1. Scheme of the implementation of autotrophic biological nitrogen removal process in
the main water line of an urban wastewater treatment plant.
![Page 33: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/33.jpg)
Chapter 2. General Introduction
10
When autotrophic BNR is implemented, aeration costs are reduced because of the
lower oxygen requirements of the process compared to conventional activated sludge
treatment; and furthermore, biogas production is increased since most of the organic matter
will be converted to biogas in the anaerobic digestion process, with the consequent energy
recovery. In fact, according to Kartal et al. (2010) calculations, a facility where conventional
CAS treatment is used presents a net energy consumption of 44 Wh p-1 d-1 but if anammox is
implemented in the main water line the facility could present a net energy production of 24
Wh p-1 d-1. Table 2.1 presents a comparison of operational requirements of the autotrophic
BNR process compared to CAS systems in an urban WWTP.
Table 2.1. Comparison of the main operational requirements of the autotrophic BNR process
implemented in the mainstream and/or in the sidestream of an urban WWTP in reference to a
CAS treatment. Data obtained from Kartal et al. (2010) and Morales et al. (2015).
Autotrophic BNR process in the sidestream
Autotrophic BNR process in the mainstream
Aeration requirements (including COD and N removal) - 16–26 % - 50 %
Energy recovery through biogas production + 18–34 % + 67–84 %
Sludge generation + 17 % + 9 %
Nitrous oxide emissions - 22 % - 83 %
Pumping/Mixing energy 0 % - 25 %
2.2.2. Implementation of anammox-based technologies for nitrogen removal in
urban WWTPs: from sidestream to mainstream
Autotrophic BNR can be implemented as a one-stage system, where partial nitritation
and anammox processes (PN/A) take place in the same reactor, or as a two-stage system,
when partial nitritation and anammox processes are separated in two different reactors. In
one-stage systems a co-culture of AOB and anammox bacteria is established under
microaerobic conditions to avoid inhibition of anammox bacteria by oxygen and to achieve
appropriated conditions to obtain partial nitritation (Van Hulle et al., 2010). The use of one
single reactor leads to lower capital costs than two-stage systems; however difficulties in
dissolved oxygen regulation can appear triggering to the eventually growth of NOB and the
destabilization of the process (Hao et al., 2002). Two-stage systems present higher capital
![Page 34: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/34.jpg)
Chapter 2. General Introduction
11
costs than one-stage systems but make possible a more stable performance and control. In
addition, the use of a two-stage system avoids the negative effects of organic compounds
present in the influent on anammox bacteria and, besides, allows complete anoxic conditions
in the anammox reactor.
Autotrophic BNR has been successfully applied for treating some industrial
wastewaters and reject water from digested sludge (sidestream in urban WWTPs), since they
present more advantageous conditions for autotrophic BNR. The high ammonium
concentrations and the elevated temperatures typical of sidestream (500–1500 mg N L-1 and
temperature higher than 30 ºC) allow a more efficient NOB repression and process stability.
During the last decade, numerous full scale facilities have implemented autotrophic BNR in
the sidestream by using different technologies: sequencing batch reactors (SBRs) (Wett,
2007), granular reactors (Castro-Barros et al., 2015), moving bed biofilm reactors
(Rosenwinkel and Cornelius, 2005), rotating biological contactors and even activated sludge
systems (Desloover et al., 2011). Two-stage systems were used in the first place for
implementing the autotrophic BNR, because allowed a better control of partial nitritation and,
in addition, the use of the already existing nitritation systems like SHARON (Single reactor
High activity Ammonia Removal Over Nitrite); however, with more knowledge gained about
the process, one-stage systems became the most implemented systems at full-scale with the
88% of all the installations and the 75% of the installations implemented in urban WWTPs
(Lackner et al., 2014) due to the lower investment costs and effectiveness.
Recently, several technologies have been patented and widely used in European and
North American countries for treating industrial and sidestream wastewater, differing mainly
in: the type of system (one- or two-stage system), the state of biomass (suspended or
attached), the feeding strategy, the control of aeration, etc. One of the first autotrophic BNR
systems implemented at full scale was the two-stage system SHARON/ANAMMOX® from
Paques in Rotterdam, The Netherlands. However, since 2006, Paques changed its perspective
and aimed for the implementation of one-stage installations, which guaranteed good results
with lower investment costs. Technologies as DEMON® (aerobic/anoxic deammonification),
OLAND® (Oxygen Limited Autotrophic Nitrification and Denitrification), CANON®
(Completely Autotrophic Nitrogen removal Over Nitrite), SNAP® (Single-stage Nitrogen
removal using Anammox and Partial nitritation), ELAN® (Eliminación Autótrofa de
Nitrógeno), ANITAMox™ or DeAmmon® are some of the patented technologies for the one-
stage systems performing autotrophic BNR. Besides of those patented technologies, some
![Page 35: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/35.jpg)
Chapter 2. General Introduction
12
facilities have implemented their own strategies for achieving autotrophic BNR in the
sidestream. The high variety of technologies already implemented at full-scale highlights the
success of the autotrophic BNR implementation when a high-strength and warm stream is
treated.
Nevertheless, despite of the successful implementation of autotrophic BNR in the
sidestream, it has never been applied in the main water line of an urban WWTP (low-strength
and cold wastewater). The typical conditions of the mainstream, with temperatures as low as 8
ºC during winter (De Clippeleir et al., 2013), nitrogen concentrations lower than 80 mg N L-1
(Clippeleir et al., 2011) and the possible input of organic matter from the A-Stage, are not
advantageous for implementing partial nitritation and anammox process, since the NOB
repression is more challenging at low temperature and, furthermore, a competition between
autotrophic and heterotrophic bacteria can appear. Hence, the application of the autotrophic
BNR in the mainstream of an urban WWTP with high nitrogen removal rates and a good
effluent quality is nowadays a challenge.
Recently, different alternatives have been proposed for implementing the autotrophic
BNR at mainstream conditions. Initially, studies focused on the use of one-stage systems due
to the successful results obtained at sidestream conditions and the lower investment costs
associated. Table 2.2 shows the most recently studies which implemented partial nitritation
and anammox process in one-stage systems at mainstream conditions. Most systems focused
on the use of oxygen-limiting conditions to achieve an efficient NOB repression and maintain
the anammox bacteria activity. Thus, innovative systems such as the use of integrated fixed
film activated sludge (IFAS) reactors, where a combination of moving bed biofilm (mainly
responsible for anammox activity) and suspended sludge (mainly responsible of aerobic
ammonium oxidation) are integrated and operated under transient oxygen and anoxic
conditions (Malovany et al., 2015); or the use of most commonly studied systems such as
SBRs operating with suspended or granular biomass (Gilbert et al., 2015) and even the
comparison of moving bed biofilm reactors with different types of carriers (Gilbert et al.,
2015) were tested to achieve stable operation in one-stage systems. Nevertheless, most cases
showed nitrate accumulation due to the decrease of anammox bacteria activity at the same
time that NOB activity increased (Table 2.2), and even those systems which achieved an
efficient NOB repression operated at high temperature (25 ºC, Li et al. 2016) and/or achieved
low nitrogen conversion rates (0.015 g N L-1 d-1, Gilbert et al., 2014).
![Page 36: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/36.jpg)
Chapter 2. General Introduction
13
Overall, data from Table 2.2 shows that the main challenge for the implementation of
PN/A in one-stage systems at mainstream conditions is achieving an efficient NOB repression
at low temperature and high nitrogen removal. Recently, the two-stage systems have been
presented as an alternative of great interest to overcome the drawbacks associated to one-stage
systems (Ma et al., 2011; Pérez et al., 2015) and numerous studies tried to demonstrate the
feasibility of the two-stage implementation.
On the one hand, different strategies were reported to achieve a stable partial
nitritation at mainstream conditions in a single reactor with an efficient NOB repression and a
suitable effluent for a subsequent anammox reactor. For instance, Gao et al. (2014) reported
stable NOB repression at room temperature (12-27 ºC) in a lab-scale SBR by applying a
control strategy which controlled the duration of the aeration phase needed to enable half-
ammonia oxidation according to the ammonium and COD concentrations in the influent and
the temperature of operation. At pilot scale, Regmi et al. (2014) proposed an operational and
process control strategy based on optimizing the COD concentration in the influent, imposing
transient anoxia and aggressive solids retention time operation (close to AOB washout) and
operating at high DO in a continuously stirred tank reactor at 25 ºC. Regarding stable
operation at long-term, stable partial nitritation with efficient NOB repression was reported by
Isanta et al. (2015a) in a granular sludge airlift reactor operating at 12.5 ºC by applying a
control strategy based on maintaining a low ratio between oxygen and ammonium
concentrations in the bulk liquid of the reactor.
On the other hand, the successful operation of a single anammox reactor at such
adverse mainstream conditions was also assessed. Different reactors were chosen to prove the
stability of the anammox process at mainstream conditions. Thus, Ma et al. (2013) reported
successful anammox operation in an upflow anaerobic sludge blanket reactor treating a
synthetic influent at mainstream conditions with high nitrogen removal rates at 16 ºC.
Similarly, Lotti et al. (2014b) also reported stable long-term operation in an upflow fluidized
granular sludge reactor operating between 20 ºC and 10 ºC treating a real effluent from an A-
Stage. And more recently, Laureni et al. (2015) reported successful treatment of an
aerobically pre-treated municipal wastewater at 29 ºC by using suspended-growth anammox
biomass in SBRs and also demonstrated the feasibility of operating a SBR anammox reactor
at 12.5 ºC although with a marked decrease in activity.
![Page 37: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/37.jpg)
Table 2.2. Studies performing partial nitritation and anammox process as a one-stage system at mainstream conditions. T: temperature; NRR:
Nitrogen Removal Rate; NRE: Nitrogen Removal Efficiency; RBC: Rotating Biological Contactor; COD: Chemical Oxygen Demand; N:
Nitrogen; SBR: Sequencing Batch Reactor; MBBR: Moving Bed Biofilm Reactor; H-MBBR: Hybrid Moving Bed Biofilm Reactor; IFAS:
Integrated Fixed film Activated Sludge; UMABR: Upflow Membrane-Aerated Biofilm Reactor; NOB: nitrite-oxidizing bacteria; AMX:
anammox bacteria.
Scale Influent Biomass Reactor T
(ºC)
NRR
(g N L-1 d-1)
NRE
(%) Comments Reference
Lab-scale Synthetic Biofilm RBC 25 0.44 46 OLAND technology
NOB activity developed
Clippeleir et al. (2011)
Lab-scale Synthetic Biofilm RBC 15 0.50 36 OLAND technology
NOB activity developed
Destabilization when COD/N=1
De Clippeleir et al. (2013)
Lab-scale Synthetic Suspended SBR 12 0.03 > 90 Nitrate highly accumulated when temperature decreased to 9 ºC
Hu et al. (2013)
Lab-scale Synthetic Biofilm MBBR 10 0.015 60 NOB activity decreased causing a nitrite accumulation when temperature decreased from 13°C to 10 ºC
Gilbert et al. (2014)
Lab-scale Synthetic Granules Airlift 10 0.20 48 NOB activity developed Lotti et al. (2014a)
14
![Page 38: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/38.jpg)
Table 2.3. Continuation.
Scale Influent Biomass Reactor T
(ºC)
NRR
(g N L-1 d-1)
NRE
(%) Comments Reference
Lab-scale Synthetic Granules and biofilm
UMABR 25 0.08 81 Efficient NOB repression
Pure oxygen through membrane
Li et al. (2016)
Lab-scale Real effluent from A-Stage
Suspended SBR 10 0.01 < 25 Nitrate highly accumulated when temperature was below 12 ºC
Lackner et al. (2015)
Lab-scale Real effluent from A-Stage
Biofilm MBBR 10 0.04 < 50 Nitrate highly accumulated when temperature was below 12 ºC.
Lackner et al. (2015)
Lab-scale Real effluent from A-Stage
Biofilm and biofilm + suspended
MBBR and H-MBBR
15 0.02–0.04 70–90 Destabilization at 11 ºC Laureni et al. (2016)
Pilot-scale Real effluent from A-Stage
Biofilm + suspended sludge
IFAS 25 0.05 52 Inefficient NOB repression
Higher NRE when COD/N=1.8 due to the heterotrophic denitrification
Malovany et al. (2015)
Pilot-scale Real effluent from A-Stage
Granules Plug-flow 19 0.18 46 Minimum [NO3-]/[NH4
+] ratio achieved of 0.35, which indicated NOB activity
Lotti et al. (2015a)
15
![Page 39: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/39.jpg)
Chapter 2. General Introduction
16
2.3. THE FUTURE OF URBAN WWTPS
During the last decades, since a good effluent quality was guaranteed, the attempts for
reducing the energy associated costs and increasing the energy recovery in urban WWTPs
have been considered the most important issue on the race for achieving energetic self-
sufficient facilities. This is the reason why the development of a process such as the
autotrophic biological nitrogen removal, which could guarantee an energy-positive urban
WWTP, has appeared as a hot topic in current wastewater research. However, in the race for
achieving a sustainable urban WWTP not only the energy requirements need to be considered
but also the environmental impact of the facility. Thus, in addition to the development of
energy-efficient processes for the removal of pollutants, other subjects, as the described
below, should be taken into account:
- Greenhouse gases emissions
Nitrous oxide (N2O), carbon dioxide (CO2), and methane (CH4) are greenhouse gases
(GHGs) whose emissions are the most commonly emissions which can be produced during
wastewater treatment in urban WWTPs (Kampschreur et al., 2009). Since CH4 gas is likely
not produced during the treatment in the facilities but produced in the sewerage system and
during the sludge handling (e.g. anaerobic digestion), and CO2 is produced by the biological
treatment of organic matter (biogenic origin) and it does not contribute to the greenhouse
effect; N2O is the most significant GHG emitted during wastewater treatment in urban
WWTPs and its emissions cannot be overlooked. The source and magnitude of N2O
emissions in WWTPs (produced during biological nitrification and denitrification) are
relatively unknown and subject of debate in the literature (Kampschreur et al., 2009). For
instance, the N2O emissions associated to wastewater treatment accounted approximately the
2% of the total anthropogenic N2O emissions in U.S in 2014, corresponding to 4.8 million
metric tons of CO2 equivalents (EPA, 2016). The N2O gas presents a global warming
potential of about 300 times higher than CO2 on a 100 year time horizon (IPCC, 2013) and,
furthermore, N2O emissions are currently the most important ozone-depleting emissions and
are expected to remain the largest throughout the 21st century (Ravishankara et al., 2009).
Therefore, even low amounts of N2O emissions should be avoided in urban WWTPs; and
mitigation strategies and control of emissions are essential issues to consider in the
implementation of any process in an urban wastewater facility.
![Page 40: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/40.jpg)
Chapter 2. General Introduction
17
- Resources recovery
Nowadays the equivalent of 1.6 planets are used to provide the resources used by
humanity and absorb the waste produced (Global Footprint Network, 2016). This means that
planet Earth needs one year and six months to regenerate what humanity use in a year. Such
worrying situation brings up the need of improving the resource efficiency and the concept of
using ‘waste’ as a resource appears as an important alternative to build a more sustainable
society. Hence, urban WWTPs should be thought as potential facilities of resource recovery
both from wastewater and from sludge. In fact, phosphate recovery from wastewater and the
production of other valuable materials from sludge are emerging (e.g. the recovery of
cellulose fibers and the production of bioplastics and biopolymers) at quantities and costs that
match the current market demand and prices (van Loosdrecht and Brdjanovic, 2014). Thus,
the implementation of new processes for wastewater treatment should consider the potential
resource recovery, rather than just pollutants removal.
- Decentralized technology
WWTPs are usually the central topic when talking about sustainable wastewater
treatment, however the potential energy recovery from wastewater in sewers and households
should be also taken into account. For instance, it is known that the largest energy content of
wastewater is found as heat, with about 85% of the energy contained in urban wastewater
(Larsen, 2015). Decentralized heat recovery from warm water sources at the household level
holds a higher potential to extract useful energy, either with heat pumps or heat exchangers as
reported by Larsen (2015). It is also known that the nitrogen content of human urine accounts
for about 75% of the total nitrogen in urban wastewater, but it comprises only 1% of the
volume (Luther et al., 2015). Thus, another potential application of decentralized technology
is the urine separation at household level for subsequent fertilizer production (Luther et al.,
2015; Udert and Wächter, 2012). Hence, the implementation of decentralized processes
should be also considered a hot point to achieve a sustainable wastewater treatment.
Further research is needed to find out which is the most suitable technology for
performing a sustainable wastewater treatment. In any case, the implementation of
autotrophic BNR appears as an efficient alternative to achieve a sustainable urban WWTP
from the energetic point of view, although other complementary alternatives cannot be
overlooked. Furthermore, the most appropriated process to guarantee effluent quality with a
sustainable operation can be different for each independent case, according to the land
![Page 41: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/41.jpg)
Chapter 2. General Introduction
18
availability, the possibility of resource recovery, the characteristics of the wastewater, the
possibility of modify the actual processes in the facility or build a new plant, etc.
![Page 42: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/42.jpg)
Chapter 3
OBJECTIVES OF THE THESIS
![Page 43: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/43.jpg)
Chapter 3. Objectives of the thesis
20
![Page 44: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/44.jpg)
Chapter 3. Objectives of the thesis
21
The main objective of this thesis was to demonstrate the feasibility of implementing
the autotrophic biological nitrogen removal process as a two-stage system in the main water
line of urban wastewater treatment plants. Thus, this thesis aimed at demonstrating the
stability of partial nitritation and anammox processes in two separated reactors treating
wastewater at mainstream conditions.
More specifically, the goals of this thesis were:
To demonstrate the long-term stability of partial nitritation and anammox
processes treating an urban influent at mainstream conditions with granular sludge
reactors operated in continuous mode.
To propose the use of Upflow Anaerobic Sludge Blanket (UASB) reactors as a
good alternative for the implementation of the anammox process at mainstream
conditions.
To demonstrate that high nitrogen removal efficiencies and high nitrogen removal
rates can be achieved operating a two-stage system for the autotrophic biological
nitrogen removal in urban influents.
To study in depth the biomass developed in partial nitritation and anammox
reactors from the microbiological, kinetic and physicochemical points of view
during the operation at mainstream conditions.
To determine the nitrous oxide emissions (N2O) from a partial nitritation reactor
treating an influent at mainstream conditions and, in addition, to evaluate the effect
of temperature on the N2O emissions produced in the partial nitritation reactor.
![Page 45: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/45.jpg)
Chapter 3. Objectives of the thesis
22
![Page 46: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/46.jpg)
Chapter 4
GENERAL MATERIALS AND METHODS
![Page 47: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/47.jpg)
Chapter 4. General Materials and Methods
24
![Page 48: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/48.jpg)
Chapter 4. General Materials and Methods
25
4.1. DESCRIPTION OF THE REACTORS AND EXPERIMENTAL SET-UP
4.1.1. Lab-scale airlift reactor
A lab-scale airlift reactor with a total volume of 5.2 L, with a downcomer-to-separator
diameter ratio of 0.36 and a total length-to-downcomer diameter ratio of 16 was used (Fig.
4.1). Compressed air was supplied through an air diffuser placed at the bottom of the reactor
and the dissolved oxygen (DO) concentration in the bulk liquid was measured on-line by
means of a DO electrode (DO 60-50, Crison Instruments, Spain). The pH was measured on-
line with a pH probe (pH 52-10, Crison Instruments, Spain). The temperature was measured
in the bulk liquid and controlled by means of a cooling system (E100, LAUDA, Germany)
and an electric heater (HBSI 0.8 m, HORST, Germany) connected to a temperature controller
(BS-2400, Desin Instruments, Spain). Total ammonia nitrogen (TAN = N-NH4+ + N-NH3)
and nitrate concentrations in the bulk liquid were measured by using an on-line probe (AN-
ISE sc probe with a Cartrical cartridge plus, Hach Lange, Germany). The range of the on-line
probe for TAN and nitrate concentrations was 0-1000 mg N L-1 whereas the detection limit
was 0.2 mg N L-1 for both parameters.
Fig. 4.1. Image of the lab-scale airlift reactor (A) and schematic diagram of the set-up
showing the peripheral instrumentation and control loops (B).
![Page 49: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/49.jpg)
Chapter 4. General Materials and Methods
26
4.1.2. Lab-scale UASB reactor
A lab-scale UASB reactor with a working volume of 2 L including the gas-liquid-solid
separator was used for the implementation of the anammox process (Fig. 4.2). The inner
diameter of the column was 51 mm and the total-reactor-height to column-diameter ratio was
12.5. The pH of the reactor bulk liquid was not controlled but measured offline, while the pH
of the influent was set to values around 7.5 to avoid any shock of pH in the reactor. Influent
was devoid of oxygen since influent tank was periodically flushed with dinitrogen gas (N2) to
guarantee a DO concentration lower than 0.3 mg O2 L-1. Additionally, N2 gas was introduced
into the reactor headspace. DO concentration was measured in the bulk liquid of the reactor
by means of a DO electrode (DO 60-50, Crison Instruments, Spain). The temperature was
measured and controlled by means of a cooling system and an electric heater (HBSI 0.8m,
HORST, Germany) connected to a temperature controller (BS-2400, Desin Instruments,
Spain). The cooling system consisted of a tube surrounding the column of the UASB reactor
with a continuous recycling of cold antifreeze liquid at temperature c.a. -5 ºC.
Fig.4.2. Image of the lab-scale UASB reactor (A) and schematic diagram of the set-up
showing the peripheral instrumentation (B).
![Page 50: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/50.jpg)
Chapter 4. General Materials and Methods
27
4.2. ANALYTICAL METHODS
The influent, effluent and biomass of the reactors were characterised throughout the
different experiments performed during this thesis. Hence, different analytical methods were
applied. In this section only the common analysis for all the experiments are detailed. More
specific analytical methods and techniques used for each experiment will be detailed in the
corresponding chapter of results.
4.2.1. Analysis of nitrogen species: ammonium, nitrite and nitrate
Samples were previously filtered by 0.22 μm. Total ammonia nitrogen concentration
was analysed off-line with an ammonium analyser (AMTAX sc, Hach Lange, Germany).
Nitrite and nitrate concentrations were analysed off-line with ionic chromatography using an
ICS-2000 Integrated Reagent-Free IC system (DIONEX Corporation, USA).
4.2.2. Chemical oxygen demand
Chemical oxygen demand (COD) was analysed by using colorimetric Hach Lange kits
(LCK314) and the DR2800 Hach Lange spectrophotometer. Total COD was directly
measured by using the kits, while samples where soluble COD was analysed were previously
filtered by 1.6 µm. Samples were analysed in triplicates.
4.2.3. Settling properties
Settling velocity was determined for at least 30 individual granules by dropping the
individual granule in a glass cylinder containing tap water and measuring the time spent
settling a known distance. Sludge volumetric index (SVI) was analysed in duplicates
according to Standard Methods (APHA, 2005).
4.2.4. Total and volatile solids concentrations
Total suspended solids (TSS) and volatile suspended solids (VSS) were analysed
according to Standard Methods (APHA, 2005). Samples were analysed in triplicates. First,
samples were filtered through previously weighted (W1) standard glass microfiber filters of
0.7 μm (GF/F grade, Whatman, USA) and dried at 105 ºC until constant weight (W2) (c.a. 2.5
hours). The relation between the difference between W1 and W2 and the sample volume was
the concentration of TSS. Then, sample was ignited at 550 ºC for about 45 min and weighted
(W3). The difference between W1 and W3 per volume of sample represented the concentration
![Page 51: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/51.jpg)
Chapter 4. General Materials and Methods
28
of VSS. Total solids (TS) and volatile solids (VS) concentrations were calculated following
the same procedure without the filtering step. In this case, samples were weighted using
metallic dishes.
4.3. MICROBIAL ANALYSIS
Two molecular biology techniques were used to identify and quantify the
microorganisms present in sludge samples: fluorescence in situ hybridization and
pyrosequencing.
4.3.1. Fluorescence in situ hybridization (FISH)
-Sample fixation
Biomass samples were grabbed from the reactor and the granules were crushed by
means of a mortar and a pestle in order to ease hybridization. Then, biomass was fixed by
adding three volumes of 4% (v/v) paraformaldehyde solution to one volume of biomass
suspension. The mixture was keep at 4 ºC for 1–3h. Afterwards, biomass suspension was
washed twice with 0.01M Phosphate Buffered Saline (PBS) solution (1:30 dilution of a
solution 0.3M PBS which was prepared from 77.4 g of Na2HPO4.12H2O, 13.1 g
NaH2PO4.2H2O and 226.2 g NaCl) and it was re-suspended in one volume of 0.01M PBS per
one volume of ice-cold ethanol 98%. Fixed biomass could be spotted onto glass slides to
starting the hybridization protocol or stored at -20 ºC for several months.
-Hybridization
The hybridization protocol was adapted from Hugenholtz et al. (2002) and Manz et al.
(1992). Suspended fixed biomass was spotted onto a glass slide and dehydrated in ethanol
series of 50, 80 and 98% (v/v) (3 min each).
For samples of anammox sludge three steps of membrane permeabilization were
performed before the dehydration with ethanol: (i) a lysozyme solution (prepared with 1 mL
0.5 M EDTA, 1 mL 1M Tris/HCl pH 8, 8 mL Milli-Q-grade water and 100 mg lysozyme) was
added to biomass and incubated at 37 ºC for 1.5 h; then (ii) fresh achromopeptidase solution
was added to biomass and incubated at 27 ºC for 30 min. To prepare the achromopeptidase
solution 10 mL of achromopeptidase buffer (100 µL 5M NaCl, 500 µL 1M Tris/HCl pH 8 and
![Page 52: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/52.jpg)
Chapter 4. General Materials and Methods
29
50 mL of Milli-Q-grade water, pH 8) were mixed with 20 µL achromopeptidase stock
solution (the lyophilized powder as come from supplier (Sigma-Aldrich, ref.: A3547-100KU)
was dissolved in Milli-Q-grade water to prepare a stock solution of 3KU/ml). Finally, (iii)
biomass was washed with Milli-Q-grade water before dehydrating with ethanol series.
After dehydration with ethanol and when glass slide was dry, 10 μL of hybridization
buffer were added plus 1μL of (each) probe working solution (probe concentration of 50 ng
μL-1). Solution was mixed without scratching the slide and cell layer. Hybridization buffer
contained: 360 μL of 5M NaCl (autoclaved), 40μL of 1 M Tris/HCl (autoctaved), 2μL of 10%
SDS, 898 μL of Milli-Q-grade water, and the corresponding amount of formamide for each
molecular probe. The slide was placed in a 50 mL Falcon tube containing a moistened tissue
and the tube was closed and put in the hybridisation oven at 46 ºC for 2 hours. After
hybridization, the slides were quickly transferred to the washing buffer tube by immersing the
whole slide in the pre-warmed washing buffer at 48 ºC for 15 min. Washing buffer contained
80μL of NaCl 5M (autoclaved), 500μL EDTA 0.5M, 1mL Tris/HCl 1M (autoclaved), 43.8mL
Milli-Q-water (autoclaved) and 50μL 10% SDS. After washing, the slide was rinsed with cold
Milli-Q-grade water. Afterwards, all droplets of water were removed from the slide by
directly applying compressed air to the slide. To finish, a mounting medium (specifically
Fluoprep) was applied for the subsequent microscopic observation.
Hybridizations were carried out using at the same time the general bacteria probe and
the specific probes for the specific microorganisms, which wanted to be identified. The
general bacteria probe was an equal mixture of probes EUB338I, EUB338II and EUB338III
for all Bacteria. All the probes used for the experiments of this thesis are shown in Table 4.1.
-Microscope observation and quantification
A Leica TCS-SP5 confocal laser scanning microscope (Leica Microsystem Heidelberg
GmbH; Mannheim, Germany) using a Plan-Apochromatic 63x objective (NA 1.4, oil) was
used for biomass quantification. The quantification was performed following an automated
image analysis procedure described in Jubany et al. (2009a), where at least 30 microscopic
fields were analysed and a single-z position was selected based on the highest intensity for
each sample.
![Page 53: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/53.jpg)
Table 4.1. 16S rRNA-targeted oligonucleotide probes, target microorganisms, and references used in this thesis to determine the relative
abundance of microbial population with the FISH technique.
Probe Sequence (from 5’ to 3’) 5’ Dye Specificity Reference
EUB338 I GCTGCCTCCCGTAGGAGT Cy5 Most bacteria Amann et al., 1990
EUB338 II GCTGCCTCCCGTAGGAGT Cy5 Planctomycetales Daims et al., 1999
EUB338 III CGCCATTGTATTACGTGTGA Cy5 Verrucomicrobiales Daims et al., 1999
NSO190 CGATCCCCTGCTTTTCTCC 6FAM / ALEXA594 All AOB Mobarry et al., 1996
NIT3 CCTGTGCTCCATGCTCCG Cy3/Pacific Blue/Fluos Nitrobacter spp. Wagner et al., 1996
NIT3 Competitor CCTGTGCTCCAGGCTCCG - - Wagner et al., 1996
NTSPA662 GGAATTCCGCGCTCCTCT 6FAM Nitrospira genus Daims et al., 2001
NTSPA662 Competitor GGAATTCCGCTCTCCTCT - - Daims et al., 2001
NSV443 CCGTGACCGTTTCGTTCCG Atto550 Nitrosospira spp. Mobarry et. al., 1996
BAN162 CGGTAGCCCCAATTGCTT Texas Red Candidatus Brocadia Anammoxidans Schmid et al., 2001
KST157 GTTCCGATTGCTCGAAAC Texas Red Candidatus Kuenenia Stuttgartiensis Schmid et al., 2001
BFU613 GGATGCCGTTCTTCCGTTAAGCGG Texas Red / ALEXA594 Candidatus Brocadia Fulgida Kartal et al., 2008
AMX368 CCTTTCGGGCATTGCGAA ALEXA 488 All anammox bacteria Alm et al., 1996
![Page 54: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/54.jpg)
Chapter 4. General materials and methods
31
4.3.2. Pyrosequencing analysis
Pyrosequencing was used for analysing the diversity and relative abundance of
different microorganisms in the granular sludge of the reactors.
First, DNA was extracted from biomass samples by applying the the manufacturer
protocol of MoBio PowerBiofilm™ DNA extraction kit (MoBio Laboratories, USA). Two
modifications of the manufacturer protocol were performed: 200 µL of solution BF3 were
added instead of the 100 µL recommended, and 80 µL of solution BF7, instead of the 100 µL
recommended. Once the extraction was performed, NanoDrop 1000 Spectrophotometer
(Thermo Fisher Scientific, USA) was used to measure the quantity and quality of extracted
DNA. A 260/280 nm ratio of 1.8 was used as quality cut-off and a minimum of 25 ng µL-1 of
extracted DNA was guaranteed to perform pyrosequencing.
Paired-end sequencing of the extracted DNA was performed on an Illumina MiSeq
platform by Research and Testing Laboratory (Lubbock, Texas, USA). Bacterial 16S rRNA
variable regions V2-V4 were targeted using the primer pair 341F-907R in the studies of
nitrifying population (Chapter 5) and the primer pair 315F-909R in the studies of anammox
population (Chapter 9).
Bioinformatics for the biodiversity analysis and phylogenetic classification were
performed as follows: The forward and reverse reads were merged together using the PEAR
Illumina paired-end read merger (Zhang et al., 2014), sequence reads were then sorted by
length from longest to shortest and prefix dereplication and clustering at a 4% divergence was
performed using the USEARCH algorithm (Edgar, 2010). Following, the clusters were
classified into operational taxonomic units (OTUs) using the UPARSE OTU selection
algorithm (Edgar, 2013). Chimera checking was performed using the UCHIME chimera
detection software executed in de novo mode (Edgar et al., 2011). The representative
sequences reads were mapped to their corresponding nonchimeric cluster using the
USEARCH global alignment algorithm (Edgar, 2010).
To determine the identity of each remaining sequence, the sequences were quality
checked and demultiplexed using the denoised data previously generated. Sequences that
passed the quality control screening were then clustered into OTUs using the UPARSE
algorithm (Edgar, 2013). Each of the original reads was then assigned back to their OTUs
using the USEARCH global alignment algorithm (Edgar, 2010). The centroid sequence from
each cluster was run against the USEARCH global alignment algorithm along with a database
![Page 55: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/55.jpg)
Chapter 4. General Materials and Methods
32
of high quality sequences derived from NCBI and maintained by Research and Testing
Laboratory. For each OTU, the top six matches from the high quality database were kept and
confidence values were assigned to each taxonomic level by taking the number of taxonomic
matches that agree with the best match at that level and dividing that by the number of high
quality sequence matches that were found. Each OTU was then assigned taxonomic
information using the lowest common taxonomic level whose confidence value was above
51%. OTUs that received no matches against the high quality sequences were identified as
“no hit”. After resolving the number of sequences per OTU, the percentage of each organism
was individually calculated for each sample. Data obtained provided relative abundance
information within and among individual samples. Relative abundances of reads were
calculated by taxonomic level for each library. Values represent the percentage of reads of
sequences obtained at each taxonomic identity (according to the degree that of similarity
described above) within the total set of readings from the library. In bacteria, the rRNA
operon is frequently found in multiple copies (1 to 15; Stoddard et al., 2015). Therefore, the
community structure can be biased as one may obtain sequences with a lesser abundance but
high number of reads (multiples copies of the 16S gene), or a higher abundance but low
number of reads (single copy of the 16S gene). To remove this bias, the relative abundances
of reads by taxonomic level for each library have been normalised by the average number of
copies of the rRNA operon of each taxonomic level using the database freely available at
https://rrndb.umms.med.umich.edu/.
When the taxonomy of an OTU was not assigned by using the protocol mentioned
above (resulted as either in “Unclassified”, in “Unknown” or in “no hit”), an attempt to
identify it was made by using the Basic Local Alignment Search Tool (BLAST) from the U.S.
National Library of Medicine freely available at http://blast.ncbi.nlm.nih.gov/Blast.cgi.
![Page 56: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/56.jpg)
Chapter 5
KINETIC AND MICROBIOLOGICAL
CHARACTERIZATION OF AEROBIC GRANULES
PERFORMING PARTIAL NITRITATION OF A LOW-
STRENGTH WASTEWATER AT 10 °C
![Page 57: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/57.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
34
A modified version of this chapter has been published as:
Reino, C., Suárez-Ojeda, M.E., Pérez, J., Carrera, J., 2016. Kinetic and microbiological
characterization of aerobic granules performing partial nitritation of a low-strength
wastewater at 10 °C. Water Res. 101, 147–156. doi:10.1016/j.watres.2016.05.059
![Page 58: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/58.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
35
Abstract
A granular sludge airlift reactor enriched in ammonia oxidizing bacteria (AOB) was
operated at 10 ºC performing stable partial nitritation in the long-term. The reactor treated a
synthetic low-strength influent during 250 days with an average nitrogen loading rate of 0.63
± 0.06 g N L-1 d-1. Nitrate production was barely detected, being the average concentration in
the effluent of 0.6 ± 0.3 mg N-NO3 L-1. Furthermore, a suitable effluent for a subsequent
reactor performing the anammox process was achieved. A maximum specific growth rate as
high as 0.63 ± 0.05 d-1 was determined by performing kinetic experiments with the nitrifying
granular sludge in a chemostat and fitting the results to the Monod model. Pyrosequencing
analysis showed a high enrichment in AOB (41 and 65 % of the population were identified as
Nitrosomonas genus on day 98 and 233, respectively) and an effective repression of nitrite
oxidizing bacteria in the long-term. Pyrosequencing analysis also identified the coexistence of
nitrifying bacteria and heterotrophic psychrotolerant microorganisms in the granular sludge.
Some psychrotolerant microorganisms are producers of cryoprotective extracellular polymeric
substances that could explain the better survival of the whole consortia at cold temperatures.
![Page 59: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/59.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
36
![Page 60: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/60.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
37
5.1. INTRODUCTION
Nitrogen removal is essential in urban wastewater treatment plants (WWTPs) since
nitrogenous compounds are toxic to aquatic life and cause eutrophication and oxygen
depletion in receiving waters. Conventional activated sludge systems are the most frequently
used systems in urban WWTPs since a good removal of pollutants is guaranteed, however the
costs associated to this typical biological treatment make WWTPs as very energy-demanding
facilities. For the achievement of a cost-effective (energy-neutral or even energy-positive)
urban WWTP, the implementation of the autotrophic biological nitrogen removal (BNR) in
the mainstream has been proposed (Jetten et al., 1997; Kartal et al., 2010; Siegrist et al.,
2008). Thus, aeration costs are reduced because of the lower oxygen requirements of the
process compared to conventional activated sludge treatment; and furthermore, biogas
production is increased since most of the organic matter will be converted to biogas in the
anaerobic digestion process, with the consequent energy recovery.
Recently, many studies were focused on the implementation of autotrophic BNR in
one-stage systems, such as CANON (Completely Autotrophic Nitrogen removal Over Nitrite)
and OLAND (Oxygen-Limited Autotrophic Nitrification/Denitrification) technologies.
Nevertheless, at low temperature and low-strength wastewaters most of these systems showed
the failure of nitritation in the long-term operation, due to the growth of nitrite oxidizing
bacteria (NOB) triggering the production of nitrate and the destabilization of the subsequent
anammox process (De Clippeleir et al., 2013; Hu et al., 2013; Wett et al., 2013; Winkler et al.,
2011). Even though Gilbert et al. (2014) reported stable operation at 10 ºC with synthetic low-
strength wastewater in a one-stage system, the achieved ammonium conversion rate resulted
as low as 0.015 g N L-1 d-1. Hence, two-stage systems appear as the alternative to overcome
the destabilization problems and the low conversion rates associated to one-stage systems (Ma
et al., 2011; Pérez et al., 2015; Regmi et al., 2014). Separation of the partial nitritation and the
anammox processes in two different reactors makes possible a more stable performance and
control. In fact, stable partial nitritation at 12.5 ºC with a granular sludge reactor was reported
by Isanta et al. (2015a) and long-term operation of an anammox reactor at temperatures
between 20 and 10 ºC was reported by Lotti et al. (2014b). Both of these studies treated low-
strength wastewater, demonstrating the feasibility of application of autotrophic BNR to
mainstream conditions.
![Page 61: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/61.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
38
For both, one and two-stage approaches, successful implementation of autotrophic
BNR at mainstream conditions relies on the stability of partial nitritation in the long-term, i.e.
by achieving an effective repression of NOB activity. Previous research has shown a more
sensitive temperature dependence of ammonia oxidizing bacteria (AOB) compared to that of
NOB (Hunik et al., 1994; Knowles et al., 1965; Van Hulle et al., 2010). Thus, different
strategies have been conducted in order to favour AOB over NOB activity at mainstream
conditions. On one hand, Gao et al. (2014) proposed an aeration control strategy depending
on the temperature and ammonia concentration in the influent. Efficient NOB repression was
obtained at room temperature (12-27 ºC) but temperature fluctuated daily, being lower than
15 ºC less than 10 days. On the other hand, Isanta et al. (2015a) achieved stable partial
nitritation for 300 days at 12.5 ºC in a granular sludge system, by maintaining an adequate
ratio between oxygen and ammonium concentrations in the reactor bulk liquid. However, in
northern climates, temperature can easily achieve values lower than 12.5 ºC during winter. In
fact, average temperatures of wastewater in west European region are around 17 ºC, with a
minimum of 8 ºC and a maximum of 29 ºC (De Clippeleir et al., 2013), and thus, a
temperature gradient from 20 ºC in summer to 10 ºC in winter was presented as representative
for WWTPs in moderate climates (Gilbert et al., 2015).
In the present study the first objective was to demonstrate the long-term stability of
partial nitritation at 10 ºC for low-strength synthetic wastewater in a granular sludge reactor
operated in continuous mode. Furthermore, a better understanding of the process through the
in depth study of the nitrifying biomass of the granular sludge reactor was aimed. Thus, the
second objective was to characterize the population developed at low temperature in the
reactor from both microbiological and kinetic points of view. Finally, the special
characteristics of the biomass with the nitrifying ability of the granular reactor at 10 ºC were
correlated.
5.2. MATERIALS AND METHODS
5.2.1. Reactor set-up and operation
A lab-scale airlift reactor with a total working volume of 5.2 L was used. The detailed
diagram of the reactor and set-up details are described in Section 4.1.1., Chapter 4.
Compressed air was supplied through an air diffuser placed at the bottom of the reactor and
![Page 62: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/62.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
39
was manually manipulated to maintain the dissolved oxygen (DO) concentration in the bulk
liquid in the range 0.5-2.5 mg O2 L-1. The pH was measured on-line and automatically
controlled at 8.0 ± 0.1 by dosing a Na2CO3 0.5 M solution. The pH was controlled throughout
the operation period to rule out any potential effects derived from pH changes. Since the
effect of pH on nitritation rates is known to be reduced in the range 7.5-8, a pH set point of 8
was selected, as done in a previous study (Isanta et al., 2015a). The temperature was
measured and controlled at 10 ºC. Total ammonia nitrogen (TAN = N-NH4+ + N-NH3) and
nitrate concentrations in the bulk liquid were measured on-line. TAN concentration in the
bulk liquid was automatically controlled by varying the inflow rate by means of a
proportional controller during the whole period of operation, except between days 93-95, 144-
172 and 241-245 when the control was manually made based on the off-line bulk liquid TAN
concentration measurement.
5.2.2. Inoculum and influent characteristics
The reactor treated a synthetic influent with an average TAN concentration of 70 mg
N L-1, which mimics a pretreated municipal wastewater coming from the mixture of the
effluent of a previous A-stage plus the recirculation of the reject water of the digested sludge,
as in an anammox-based WWTP (Isanta et al., 2015a; Kartal et al., 2010). The synthetic
influent also contained: 45 mg L-1 KH2PO4, 784 mg L-1 NaHCO3, 80 mg L-1 NaCl, 40 mg L-1
CaCl2, 90 mg L-1 MgCl2 and 1 mL of trace elements solution per L of influent (Guerrero et
al., 2011).
The biomass was enriched in AOB and adapted to low temperature (12.5 ºC) in a
reactor which was operating for more than 400 days performing stable partial nitritation
(Isanta et al., 2015a). Hence, the inoculum contained around 81 ± 12 % of AOB and 1 ± 1 %
of NOB as analyzed by fluorescent in situ hibridization (FISH).
5.2.3. Kinetic experiments
Kinetic experiments were conducted in a chemostat with a working volume of 2.9 L
(Fig. 5.1). For each experiment, the chemostat was inoculated with nitrifying granules from
the continuous airlift reactor to a final concentration of 83 ± 3 mg VSS L-1. The same
synthetic wastewater of the reactor was used as influent to carry out the kinetic experiments.
DO was measured in the bulk liquid and it was maintained in excess to avoid oxygen
limitations (around 9 mg O2 L-1). Biomass was mixed both by mechanical stirring at 100 rpm
![Page 63: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/63.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
40
(Stirrer type BS, VELP Scientifica, Italy) and bubbling of air to avoid mass transfer
limitations. The pH was monitored and controlled at 7.5 by using an ON/OFF control system
by automated addition of 1 M NaOH with an automatic dispensing burette (Multi-Burette 2S-
D, Crison Instruments, Spain). Temperature was maintained at 10 ºC by means of a cooling
system (E100, LAUDA, Germany), which provided cooled water through the jacket of the
chemostat. The measurement of the particle size of the biomass of both the effluent and the
reactor confirmed that biomass was not retained in the reactor and consequently the operation
was as a chemostat (Fig 5.2).
Fig. 5.1. Image of the lab-scale chemostat used for the kinetic experiments.
Taking into account that dilution rate is equal to growth rate (µ) in a chemostat, the
growth rate was fixed by varying the dilution rate, and thus the inflow. The chemostat was
operated continuously and experiments were finished when steady state conditions were
achieved, that is, when TAN concentration in the effluent was constant. Five experiments
were carried out at different growth rates ranging from 0.36 to 0.56 d-1, and a value of TAN
concentration at steady state conditions was obtained for each experiment.
![Page 64: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/64.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
41
Kinetic parameters (maximum specific growth rate, µmax, and TAN affinity constant,
KS,TAN) were determined by fitting the data of the experiments to the Monod equation (Eq.
5.1).
= [ ]
, [ ] (Eq. 5.1)
Fig. 5.2. Particle size distribution of the nitrifying biomass in the chemostat and in the
effluent for one kinetic experiment at steady state conditions.
5.2.4. Fluorescence in situ hybridization (FISH)
Abundances of AOB and NOB were analysed by FISH coupled to confocal laser
scanning microscopy (CLSM). Regarding AOB, specific probes for Nitrosomonas spp. and
Nitrosospira spp. were 5’-6FAM-labeled and 5’-Atto550-labeled, respectively. Regarding
NOB, specific probes for Nitrobacter spp. and Nitrospira spp. were 5’-Cy3-labeled and 5’-
6FAM-labeled, respectively. The general probe for all microorganisms was 5’-Cy5-labeled.
Hybridization protocol and probes are fully described in Section 4.3.1 of Chapter 4.
5.2.5. Pyrosequencing analysis
Identification of the microbial population was performed using next-generation
sequencing at samples from days 98 and 233 of the reactor operation. DNA extraction,
pyrosequencing settings and bioinformatics applied are described in Section 4.3.2, Chapter 4.
Particle diameter (m)
10 100 1000 10000
Vol
ume
of p
artic
les
(%)
0
2
4
6
8
10
12
14
16Particle Diameter Distribution EffluentParticle Diameter Distribution Reactor
![Page 65: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/65.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
42
Bacterial 16S rRNA variable regions V2-V4 were targeted using the primer pair 341F-907R.
For bacteria biodiversity analysis and phylogenetic classification reads shorter than 100 bps
and larger than 566 bps were trimmed, and the followed methodology is explained in detail in
Section 4.3.2 of Chapter 4. Relative abundances of reads were determined by taxonomic
level. Indices of biological diversity (Shannon), richness (Chao), and rarefaction curves were
calculated for all libraries at 97, 95 and 90% of similitude. Table AI.1.1 and Figs. AI.1.1 and
AI.1.2 in the Annex I – Section I show the indices of biological diversity and rarefaction
curves, respectively. All these results indicate the libraries were comparable in terms of
abundance percentages and that good coverage of diversity was reached.
5.2.6. Scanning electron microscopy
A biomass sample of 8–10 granules was fixed in 2.5% (v/v) glutaraldehyde and 0.1 M
phosphate buffer (pH 7.4) for 2 h at 4 °C, washed 4 times for 10 min each time in 0.1 M
phosphate buffer, fixed in 1% (wt/v) osmium tetraoxide with 0.7% ferrocyanide in phosphate
buffer, washed in water, dehydrated in an ascending ethanol series (50, 70, 80, 90, and 95%
for 10 min each and twice with 100% ethanol), and dried at critical-point with CO2. Then, the
sample was metalized with Au-Pd and observed by using a scanning electron microscope
(EVO MA10; Zeiss, Germany) at the following conditions: 20 kV, 100 pA, secondary
electron detector (SE1).
5.2.7. Specific analytical methods
TAN, total nitrite nitrogen (TNN) and nitrate concentrations were measured off-line
according to Section 4.2.1, Chapter 4. These measured off-line values are the ones represented
in the results section. Solid retention time (SRT) was estimated by dividing the amount of
VSS in the reactor by the sludge washed out with the effluent (Eq. 5.2).
= [ ] ∗[ ] ∗
(Eq. 5.2)
where, [VSS]reactor and [VSS]effluent are the VSS concentrations in the reactor and the effluent,
respectively, Vreactor is the reactor volume and Qeffluent is the effluent flow rate.
Average particle size was measured by a laser particle size analysis system (Malvern
Mastersizer Series 2600, Malvern instruments Ltd., UK). The off-gas of the reactor was
periodically collected and analyzed with gas chromatography (Agilent Technologies 6890 N
Network GC system, Madrid, Spain) to measure N2O emissions.
![Page 66: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/66.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
43
5.3. RESULTS AND DISCUSSION
5.3.1. Long-term operation at 10 ºC
The reactor was previously operated at 12.5 ºC, with an average NLR of 0.7 ± 0.3 g N
L-1 d-1, for more than 400 days performing stable partial nitritation before the temperature was
directly lowered to 10 ºC (Isanta et al., 2015a). After the decrease in temperature (day 0), the
reactor was operated during 250 days with an average nitrogen loading rate (NLR) of 0.63 ±
0.06 g N L-1 d-1. Stable partial nitritation was maintained in the long-term at 10 ºC (Fig. 5.3),
which was achieved by applying a ratio of DO/TAN concentrations in the bulk liquid of 0.04
± 0.02 mg O2 mg-1 N. Low DO/TAN concentrations ratio was reported before to maintain
stable partial nitritation in granular systems (Bartrolí et al., 2010; Isanta et al., 2015a; Jemaat
et al., 2013). Efficiency of the NOB repression is thought to be linked to the fact that a steep
oxygen gradient is present in the granular sludge (Bartrolí et al., 2010; Isanta et al., 2015a).
Therefore, direct extrapolation of this strategy to other systems, such as flocculent sludge
reactors in which sludge retention is assured by other means, it is not straightforward but
might be object of future research. Nitrate production was barely detected, being the average
concentration in the effluent of 0.6 ± 0.3 mg N-NO3- L-1. Furthermore, a suitable effluent for a
subsequent reactor performing the anammox process was achieved, with an average
TNN/TAN concentrations ratio of 1.1 ± 0.2. The ammonium oxidation rate (AOR) was
maintained stable during the whole operation, with an average value of 0.34 ± 0.06 g N L-1 d-1.
This value is considerably high compared to the one obtained in one-stage biofilm systems.
Thus, Gilbert et al. (2015) reported an AOR lower than 0.02 g N L-1 d-1 at 10 ºC and Hu et al.
(2013) reported an AOR of 0.03 g N L-1 d-1 at 12 ºC.
Particle size was maintained stable during the whole period of operation (Fig. 5.3A)
with an average value of 810 ± 70 µm. From day 50 onwards, the biomass concentration
increased to an average value of 3.6 ± 0.1 g VSS L-1, as shown in Fig. 5.3A. In spite of the
high and constant NLR and AOR achieved in the granular airlift reactor, specific rates
(specific nitrogen loading rate, sNLR; specific ammonium oxidation rate, sAOR) decreased
during the first 100 days at 10 °C (Fig. 5.3C). However, sAOR remained constant from day
100 with an average value of 0.18 ± 0.03 g N mg-1 VSS d-1. This fact demonstrated that
biomass maintained the same activity during 150 days of operation at 10 ºC.
![Page 67: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/67.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
44
Fig. 5.3. Continuous operation of the granular airlift reactor treating a synthetic low-strength
wastewater at 10 °C. (A) Biomass concentration and particle size; (B) Nitrogen loading rate
(NLR) and ammonium oxidation rate (AOR); (C) Specific nitrogen loading rate (sNLR),
specific ammonium oxidation rate (sAOR) and dissolved oxygen concentration (DO); (D)
Nitrogen compounds concentrations throughout the operation of the granular reactor.
NLR
, AO
R
(g N
L-1
d-1)
0.00
0.25
0.50
0.75
1.00
1.25NLRAOR
Time (days)0 50 100 150 200 250
N-C
once
ntra
tions
(mg
N L
-1)
0
20
40
60
80
TAN Influent TAN Effluent TNN Effluent Nitrate Effluent
Parti
cle
size
(m
)
600700800900100011001200
Biom
ass
conc
entra
tion
(mg
VSS
L-1
)
1000
2000
3000
4000
5000Particle sizeBiomass concentration
sNLR
and
sAO
R(g
N g
-1 V
SS d
-1)
0.1
0.2
0.3
0.4
0.5
DO
Con
cent
ratio
n(m
g O
2 L-1
)
0.0
0.51.01.52.02.53.0
sNLR DO sAOR
A
B
C
D
![Page 68: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/68.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
45
Between days 93–95, 144–172 and 241–245 the ammonium control was switched
from automatic to manual, but the process remained stable. Moreover, on day 98 the reactor
remained without feeding for 4 hours (NLR of 0 g N L-1 d-1) which resulted in an increase of
DO and complete oxidation of ammonium to nitrite by AOB. Despite of the high
concentration of TNN and DO, the nitrate in the bulk liquid was only 2.2 mg N-NO3- L-1 and
the next day the system was totally recovered. Hence, the successfully repression of NOB in
the system was demonstrated and thus, the stability of this technology.
The balance of nitrogen during the operation of the reactor was fulfilled, with an
average value of 96 ± 6% (Fig. 5.4). Hence, neither heterotrophic nor autotrophic (anammox
process) denitrification was considered to take place in the granular airlift reactor.
Fig. 5.4. Fulfillment of the nitrogen balance during the operation of the granular airlift reactor
treating synthetic low-strength wastewater at 10 °C. The continuous line indicates the 100%
fulfillment of the N-balance.
Off-gas samples from days 94, 95, 241, 242 and 245 were analyzed in order to
calculate the N2O emission factor of the reactor. As it is shown in Table 5.1, less than 0.35%
of the TAN in the influent was emitted as N-N2O. Furthermore, from the converted nitrogen
the average emitted as N-N2O was 0.36 ± 0.07%. Thus, the N2O emissions from the granular
airlift reactor performing partial nitritation of a low-strength wastewater at 10 °C were very
low, even at low DO concentrations (1.3 ± 0.3 mg O2 L-1) which is known to trigger high N2O
emissions (Kampschreur et al., 2009). Applying the same control strategy but treating a reject
Time (days)0 50 100 150 200 250
% N
-bal
ance
fulfi
llmen
t
70
80
90
100
110
![Page 69: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/69.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
46
water from the dewatering of digested sludge (high-strength wastewater) at 30ºC, the N2O
emission factor was as high as 6% of the TAN oxidized at a DO of 1 mg O2 L-1 (Pijuan et al.,
2014), which means more than one order of magnitude higher than the reported in this study.
Hence, the temperature could be an important factor affecting N2O emissions, the lower the
temperature the lower the emissions. Nevertheless further experiments are necessary to
confirm this hypothesis, since other factors could cause the difference between the results of
Pijuan et al. (2014) and this study.
Table 5.1. N2O emission factors during the operation of the granular airlift reactor treating a
synthetic low-strength wastewater at 10 °C.
Day N-N2O
(% of N-influent)
N-N2O
(% of N-oxidized)
94 0.13 ± 0.01 0.23 ± 0.02
95 0.32 ± 0.04 0.58 ± 0.08
241 0.23 ± 0.04 0.40 ± 0.08
242 0.17 ± 0.06 0.30 ± 0.10
245 0.14 ± 0.02 0.28 ± 0.04
5.3.2. Kinetics
As it was mentioned before, the granular airlift reactor not only achieved stable partial
nitritation at 10 ºC but also operated at higher NLR than other similar systems. Nitrifying
capacity is related to the growth rate of AOB community and, hence, a nitrifying sludge with
an unusually high maximum growth rate could explain the high activity in this airlift reactor.
The results of the five kinetic experiments carried out in a chemostat reactor are
presented in Table 5.2. An increase in the applied growth rate caused an increase in the TAN
concentration at steady state conditions, which follows satisfactorily (R2 = 0.97) the Monod
kinetic model (Fig. 5.5). Hence, the maximum specific growth rate and TAN affinity constant
were obtained by fitting the data achieved in each experiment to the Monod kinetic model.
Thus µmax and KS,TAN resulted in 0.63 ± 0.05 d-1 and 2.1 ± 0.7 mg N L-1, respectively.
![Page 70: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/70.jpg)
Table 5.2. Operational parameters of the kinetic experiments in the chemostat at steady state conditions. All the experiments were conducted
with the same influent of the main reactor at pH = 7.5 ± 0.1, DO = 9.3 ± 0.1 mg O2 L-1 and T = 10 °C.
Number of
Experiment
Experiment duration
(days)
µ
(d-1)
Inflow
(L d-1)
[TAN]effuent
(mg N L-1)
[TNN]effluent
(mg N L-1)
[N-NO3-]effluent
(mg N L-1)
1 13 0.55 1.60 ± 0.01 26.3 ± 0.7 49.0 ± 2.0 1.9 ± 0.1
2 10 0.34 1.00 ± 0.01 3.4 ± 0.2 30.0± 4.0 36.0 ± 1.0
3 13 0.53 1.53 ± 0.01 10.2 ± 0.6 47.0 ± 2.0 10.8 ± 0.4
4 9 0.56 1.62 ± 0.01 10.0 ± 1.0 56.0 ± 2.0 12.0 ± 1.0
5 16 0.45 1.30 ± 0.01 4.3 ± 0.4 34.0 ± 9.0 31.0 ± 7.0
![Page 71: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/71.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
48
Fig. 5.5. TAN oxidation kinetics for the nitrifying granules. (○) TAN concentration at steady
state conditions for each specific growth rate imposed.
Different values of maximum growth rate have been reported up to now, being most of
them determined at high temperatures (20–30 ºC) (Blackburne et al., 2007; Esquivel-Rios et
al., 2014; Vadivelu et al., 2006). However, large discrepancies were found between different
studies. The large variety of parameter values found in literature lies in the differences of
systems evaluated, operational conditions applied, biomass growth types and the techniques
used to determine the parameters themselves. Vannecke and Volcke (2015) presented a
literature review on microbial characteristics of nitrifiers and reported µmax in the range of
0.34–3.40 d-1 for attached growth of AOB at 30 ºC and pH 7.5. For suspended growth, Farges
et al. (2012) used the flow cytometry technique to study the growth of Nitrosomonas
europaea in pure cultures at 26 ºC and pH 8 and µmax resulted in the range of 0.13–0.23 d-1.
On the other hand, Chandran et al. (2008) obtained higher values (µmax = 0.24–0.74 d-1) by
using respirometric batch tests and substrate depletion assays in continuous reactors for an
enriched nitrifying culture at 25 ºC and pH 7.4.
It is well known that growth rate decreases considerably with decreasing temperature.
Knowles et al. (1965) reported a decrease in the µmax from 1.5 to 0.2 d-1 when temperature
decreased from 27 to 8.3 ºC for Nitrosomonas sp. in samples from Thames estuary, London,
England; and afterwards, Sözen et al. (1996) determined µmax in the range of 0.10-0.17 d-1 for
TAN Concentration (mg L-1)
0 5 10 15 20 25 30
Spec
ific
grow
th ra
te (d
-1)
0.0
0.2
0.4
0.6
0.8
Experimental dataMonod model
![Page 72: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/72.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
49
a nitrifying mixed culture treating real urban wastewater at 10 ºC. In spite of this, little has
been published about kinetic parameters of nitrifying mixed cultures at low temperature, and
in any case, the µmax values reported were much lower than the one achieved in the current
study (µmax = 0.63 ± 0.05 d-1 at 10 ºC). In fact, to the best of the authors’ knowledge, this is
the highest growth rate achieved by a nitrifying sludge enriched in AOB at 10 ºC.
Furthermore, an estimation of the µmax of the nitrifying sludge at higher temperatures was
calculated by considering an Arrhenius-type equation (µ1,T1 = μ2,T2 θ(T1-T2)) and a temperature
coefficient of θ = 1.13 ± 0.03 which was determined in Isanta et al. (2015a) for the inoculum
of the current airlift reactor. The values obtained for µmax were 2.1 ± 0.2, 3.9 ± 0.3 and 7.3 ±
0.6 d-1 at 20, 25 and 30 ºC, respectively. Thus, the nitrifying biomass of the granular airlift
reactor presented the higher µmax than has been reported hitherto at any temperature. A
nitrifier culture with such a high µmax could explain the high NLR and AOR achieved in the
operation of the granular airlift reactor at 10 ºC. A second implication is that the enrichment
of an AOB population with such a high µmax would be an advantage for NOB repression at
low temperatures, since it would help to keep AOB growth rate higher than that of NOB.
Along with the high µmax obtained, a high value for the TAN affinity constant was
determined from the kinetic experiments (KS,TAN = 2.1 ± 0.7 mg N L-1) compared to the
previously reported by Chandran et al. (2008) at 25 ºC (KS,TAN = 0.21–0.69 mg N L-1),
Knowles et al. (1965) at 8.3 ºC (KS,TAN = 0.2 mg N L-1) and the proposed in the Activated
Sludge Model 2d at 10 ºC (KS,TAN = 1 mg N L-1; Henze et al, (2000)).
From the ecological concept, a microorganism showing quick growth on easily
available substrate is defined as r-strategist microorganism (Andrews and Harris, 1986),
which applied to the kinetic context represents a microorganism with high maximum specific
growth rate and high substrate affinity constant (Andrews and Harris, 1986; Martín-
Hernández et al., 2009). Therefore, the nitrifier population of the granular airlift reactor can
be considered as r-strategist. The enrichment of a r-strategist AOB population has been
reported when high residual ammonium concentrations are used (Terada et al., 2013). Hence,
the high residual ammonium concentration may be also a key factor for the enrichment of r-
strategist AOB population in two-stage partial nitritation/anammox reactor systems, like the
one presented in this study.
![Page 73: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/73.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
50
5.3.3. Microbial characterization
FISH-CSLM was used to evaluate the enrichment in AOB and the presence of NOB in
the granular sludge performing partial nitritation at 10 ºC. On day 233, 92 ± 4% of the
population was quantified as AOB, and less than 1 ± 1% as NOB (specifically Nitrobacter
spp.). Since the inoculum contained 81 ± 12% of AOB and 1 ± 1% of Nitrobacter spp., a high
enrichment in AOB and an effective repression of NOB was maintained in the long-term at 10
ºC although NOB were always present in the biomass.
On the other hand, neither Nitrosospira spp. (species belonging to AOB) nor
Nitrospira spp. (species belonging to NOB) hybridizations were detected in the sludge. This
fact was expected since they are k-strategist microorganisms and, consequently, they are not
favored at high TAN and TNN concentrations (Kim and Kim, 2006), such as those in the
reactor of this study.
Moreover, pyrosequencing technique was used to examine the microbial community
through the operation of the granular reactor at 10 ºC. With that purpose, samples on days 98
and 233 were analyzed.
On sample from day 98, Betaproteobacteria was clearly the most abundant class of the
total reads, with a relative abundance of 52% (Fig 5.6). It is widely known that
Betaproteobacteria class comprises autotrophic nitrifying microorganisms, such as AOB and
NOB, and also denitrifying bacteria and organic matter decomposing bacteria. Thus, it is
expected that Betaproteobacteria was the most abundant class in an AOB enriched sludge,
such as the one of this study. Alphaproteobacteria was the second class in order of
abundance, with a value of 23%, following by Actinobacteria and Gammaproteobacteria
representing the 7 and 5% of total reads, respectively, among other classes of heterotrophs
less abundant in the sample. These values of heterotrophic classes are in the range of the
observed by Kindaichi et al. (2004), with 23% of Alphaproteobacteria and 13% of
Gammaproteobacteria quantified in an autotrophic nitrifying biofilm system operating at 25
ºC and with a high-strength synthetic wastewater.
On sample from day 233, corresponding to long-term operation of the granular reactor
at 10 ºC, Betaproteobacteria increased their relative abundance to 68%, followed by the
increasing of Cytophagia with a 15%; while Alphaproteobacteria sharply decreased to 4%
(Fig. 5.6). There was a 10% of reads not identified at class level, and most of them comprised
![Page 74: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/74.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
51
the phylum Bacteroidetes. In fact, Bacteroidetes abundance increased significantly compared
to day 98, being the phylum with the highest increase (Fig. 5.7).
Fig. 5.6. Microbial diversity at class level. Relative abundance was calculated only
considering those microorganisms in which the number of 16S copies was higher than 0.5%
of the total copies. (See Annex I for detailed results and rarefaction curves).
Fig. 5.7. Microbial dynamics at phylum level between days 98 and 233. Proteobacteria
includes all the phylum except the corresponding to Nitrosomonas genus which is the genus
enriched in the sludge.
0 20 40 60 80 100
Betaproteobacteria Alphaproteobacteria Flavobacteriia Cytophagia Actinobacteria Gammaproteobacteria Anaerolineae Sphingobacteria Unclassified (BacteroidetesPhylum)Unclassified (BacteriaKingdom)No Hit
Relative abundance at class level (%)
DAY 98
DAY 233
(WithoutNitrosomonas spp)
Bacteroidetes Actinobacteria Proteobacteria
Rel
ativ
e ab
unda
nce
(%)
0
10
20
30
40
50DAY 98 DAY 233
![Page 75: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/75.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
52
At genus level, in the biomass community of day 98 (Fig. 5.8), Nitrosomonas was the
most abundant genus, which was expected since the sludge was enriched in AOB and
Nitrosomonas is the most frequently genus of AOB found in wastewater treatment systems
(Wagner et al., 2002; Wang et al., 2012). Thus, Nitrosomonas genus counted up the 41% of
the total population, indicating a majority of AOB in the sludge. Since Nitrosomonas genus
comprises r-strategist microorganisms (Terada et al., 2013), their high abundance in the
nitrifying sludge agreed with the high values of µmax and KS,TAN obtained from kinetic
experiments. Besides, Nitrosospira genus was also detected in the sample with a 7% of
relative abundance, in spite of Nitrosospira spp. were never detected by FISH technique. This
may be due to the fact that FISH technique points toward the abundance of rRNA in samples,
while pyrosequencing points toward the abundance of DNA (Wittebolle et al., 2005). Thus,
Nitrosospira spp. could be not detected by FISH because their probably low or null activity in
the reactor, but their DNA could be still detected. Regarding NOB, 1.4% of the total
population was identified as Nitrobacter genus, which agrees with the production of nitrate in
the reactor and with the result of the FISH analysis. Thus, Nitrobacter spp. were not abundant
in the reactor, but active. Finally, Nitrospira genus was not detected in the sample, in
agreement with the FISH analysis.
Fig. 5.8. Microbial diversity at genus level. Relative abundance was calculated only
considering those microorganisms in which the number of 16S copies was higher than 0.5%
of the total copies. (See Annex I for detailed results and rarefaction curves).
Relative abundance at genus level (%)
0 20 40 60 80 100
Nitrosomonas Flavobacterium Sphingomonas Nitrosospira Comamonas Flexibacter Cryobacterium Dokdonella Sphingopyxis Mesorhizobium Mycoplana No Hit Nitrobacter Acidovorax Unclassified (CytophagalesOrder) Unclassified (BacteroidetesPhylum)Unclassified (BacteriaKingdom) Others
DAY 98
DAY 233
![Page 76: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/76.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
53
Other genera were detected in a low abundance, but in a more or less equal proportion
between them. High bacteria richness is expected in mixed cultures and the coexistence and
interaction of heterotrophic bacteria and autotrophic nitrifiers were reported before (Ducey et
al., 2010; Kindaichi et al., 2004; Okabe et al., 2005). In this sense, genera as Sphingomonas
and Dokdonella, with a relative abundance in the sample of 8 and 4% respectively, were
reported as heterotrophic, or even autotrophic nitrifiers (Fitzgerald et al., 2015). Moreover,
two other genera, Cryobacterium and Flavobacterium, with several species known to be
either psychrotolerant (Cryobacterium psychrotolerans, Zhang et al. (2007); Flavobacterium
gelidilacus, Van Trappen et al. (2003)) or even psychrophilic (Cryobacterium sp. MLB-32,
Singh et al. (2015)) microorganisms, were identified in the sample with 7 and 5 % of the total
reads, respectively.
On day 233 at genus level (Fig. 5.8), enrichment in Nitrosomonas genus was observed
to the detriment of the rest of genera. Moreover, Nitrosomonas genus counted the 65% of the
total reads in the sludge sample, being at day 233 the 96% of all the Betaproteobacteria while
at day 98 this percentage was of 78%. Thus, the sludge was much more enriched in AOB at
day 233 than at the beginning of the operation at 10 ºC. Nitrosospira genus was present in the
sample in less than 0.5% of abundance, so it was not considered for the data treatment. Since
Nitrosospira was found on day 98 (7% of the reads), pyrosequencing analysis confirmed its
wash-out from the granular airlift reactor operating at 10 ºC. Furthermore, the absence of
Nitrosospira genus at day 233 confirms that Nitrosospira were not active on day 98 (no
detected by FISH) and, hence, they were washed out of the reactor. Besides, since the reactor
was operated at high solid retention time (80 ± 20 days) the wash-out was slow. There may be
two reasons for the wash-out of Nitrosospira genus in the granular airlift reactor. The first one
is that Nitrosospira spp. were not favoured at the operating conditions of the reactor since
they are k-strategist microorganisms (low TAN affinity constant and low specific growth rate)
while Nitrosomonas spp. are r-strategists (high TAN affinity constant and high specific
growth rate). The second possible explanation is that Nitrosospira spp. are more sensitive to
temperature than Nitrosomonas spp. (Hoang et al., 2014; Park et al., 2008).
Neither Nitrobacter nor Nitrospira genera were identified by pyrosequencing in the
sample of day 233, in spite of being detected with the FISH analysis (with an abundance of 1
± 1 %). Probably this could be due to poor or null amplification of a low DNA content of
these bacteria in the sample. In any case, successful NOB repression in the granular airlift
reactor operating at 10 ºC was demonstrated.
![Page 77: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/77.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
54
As it is shown in Fig. 5.8, the second genus in order of abundance with a 15% of the
total reads was unclassified at genus level (classified at order level as Cytophagales), however
its DNA sequence was ran against BLAST and matched the one found by Larose et al. (2010)
in bacteria present in snow and melt water samples from Svalbard, Norway. Therefore, the
corresponding microorganism will probably be a cold-adapted microorganism
(psychrotolerant or psychrophilic species) and its presence in cold waters would fit with the
presence in the 10 ºC system of this study.
In general terms, in addition to the enrichment in AOB, three main points can be
extracted from the results obtained by pyrosequencing in this study. The first one is that the
diversity of the bacterial community decreased in the long-term of operation at 10 ºC. The
second one is that despite the fact that the influent of the reactor was devoid of an organic
carbon source, a considerable part of the population in both samples was composed by
heterotrophic bacteria. Finally, the third one is the presence of psychrotolerant
microorganisms in the sludge performing partial nitritation at 10 ºC.
As shown in Table 5.3, there were more genera with abundances higher than 5% on
day 98 than on day 233. The decrease in bacterial diversity with cold temperature was
reported before (Karkman et al., 2011). Thus, not only non-adapted microorganisms to cold
temperatures diminished in the long-term operation, but also diversity of psychrotolerant
genera (the unclassified microorganism mentioned before appears to the detriment of
Cryobacterium and Flavobacterium). Only Nitrosomonas and the unclassified genera (one of
them corresponding to the cold-adapted microorganism mentioned before) were identified
with abundance superior to 5% on day 233.
The coexistence of nitrifying and heterotrophic bacteria in absence of an external
organic carbon source has also been reported before (Ducey et al., 2010; Hoang et al., 2014;
Karkman et al., 2011). It is known that nitrifiers produce organic matter from biomass decay
and substrate metabolism which is used by heterotrophs to survive. Nogueira et al. (2005)
correlated the presence of heterotrophs in nitrifying biofilm reactors with the hydraulic
retention time (HRT) and determined that values of HRT in the range of the one used in this
study (2.5 ± 0.3 h) guarantees enough soluble microbial products (SMP) available for
heterotrophic growth. There are also studies focused on the determination of these SMP
derived from nitrifiers that can be used by heterotrophs (Kindaichi et al., 2004; Okabe et al.,
2005).
![Page 78: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/78.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
55
Table 5.3. Genera with relative abundance higher than 5 % in samples of sludge on day 98
and 233.
Day 98 Day 233
Nitrosomonas (41%) Nitrosomonas (65%)
Nitrosospira (7%) Unclassified (Cytophagales Order) (15%)
Sphingomonas (8%) Unclassified (Bacteroidetes Phylum) (8%)
Sphingopyxis (5%)
Cryobacterium (7%)
Flavobacterium (5%)
Comamonas (5%)
Interaction between nitrifiers and heterotrophs is not only profitable for heterotrophic
bacteria, but also for nitrifiers, becoming a synergic system as it was suggested by Ducey et
al. (2010) and Hoang et al. (2014). Some psychrotolerant and psychrophilic bacteria have
been identified as producers of cryoprotective extracellular polymeric substances (EPS) that
allow a better survival of the whole consortium at cold temperatures (Ducey et al., 2010).
Therefore, this protection would affect in the same way to AOB, which could maintain the
nitritation even when conditions were not ideal for their growth. Psychrotolerant
microorganisms were found in both samples of the granular sludge and thus, they were
present during the whole operation of the granular reactor at 10 ºC. Hence, although in this
system the heterotrophic population was less significant than that of nitrifiers, its presence
could be essential for the maintenance of the nitritation in the granular reactor. Fig. 5.9 shows
a SEM image of the surface of a granule where bacteria seem to be embedded in a high
amount of extracellular polymeric substances, which could be the cryoprotective EPS.
![Page 79: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/79.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
56
Fig. 5.9 Scanning electron microscopy (SEM) images of a granule surface. Granule sample
was taken on day 45 of operation at 10 °C. (A) 1,000x magnification; (B) 10,000x
magnification; (C) 20,000x magnification.
![Page 80: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/80.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
57
This study revealed high nitrifier ability for performing partial nitritation at 10 ºC:
stable operation was maintained in the long-term in the granular airlift reactor and kinetic
experiments showed the higher µmax than has been hitherto determined for a nitrifying sludge
at low temperature. Two hypothesis could explain it: (i) AOB were cultivated in the long-term
under low temperatures which could lead to a metabolic adjustment of the biomass and thus,
to improve the ability to nitrify under this condition; (ii) granules comprised a consortium of
microorganisms which included producers of cryoprotective EPS that give an adaptive
advantage to AOB, protecting them from low temperatures.
5.4. CONCLUSIONS
Stable partial nitritation at 10 ºC was maintained in the long-term in a granular airlift
reactor operating at high NLR.
The nitrifier culture enriched in AOB presented a significantly high µmax compared to
other studies which allowed the operation at high nitritation rates, being advantageous for
NOB repression.
The microbial community was dominated by AOB (specifically Nitrosomonas genus)
throughout the whole operation of the reactor; while NOB genera were barely detected,
demonstrating their effective repression from the system. Effective NOB repression was not
only achieved, but also it was obtained a suitable effluent for a subsequent reactor performing
the anammox process.
The operation of the granular reactor in the long-term at 10 ºC with a high residual
ammonium concentration decreased the microbial diversity and further enriched the granular
sludge in AOB.
Partial nitritation at 10 ºC can be operated with low N2O emissions since less than 0.35 %
of the TAN in the influent was emitted as N-N2O.
![Page 81: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/81.jpg)
Chapter 5. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C
58
![Page 82: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/82.jpg)
Chapter 6
EFFECT OF TEMPERATURE ON N2O PRODUCTION
FROM A HIGHLY ENRICHED NITRIFYING GRANULAR
SLUDGE PERFORMING PARTIAL NITRITATION AT
MAINSTREAM CONDITIONS
![Page 83: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/83.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
60
A modified version of this chapter is being prepared for publishing as:
Reino, C., van Loosdrecht M.C.M., Pérez, J., Carrera, J., 2016. Effect of temperature on N2O
production from a highly enriched nitrifying granular sludge performing partial nitritation at
mainstream conditions. In preparation.
![Page 84: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/84.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
61
Abstract
In the race to achieve a sustainable urban wastewater treatment plant, not only the energy
requirements have to be considered but also the environmental impact of the facility. Thus,
nitrous oxide (N2O) emissions are a key-factor to pay attention to, since N2O emissions can
dominate the total greenhouse gases emissions from biological wastewater treatment. In this
study, N2O production factors were calculated during the operation of a granular sludge airlift
reactor performing partial nitritation at mainstream conditions, and furthermore, the effect of
temperature on N2O production was assessed. A 3-times increase was observed in N2O gas
emissions when temperature increased from 10 to 20 ºC, mainly due to the increase of N2O
stripping; but also an increase in the N2O production was observed in the bulk liquid of the
airlift reactor. Thus, average gas emission factors of 1.5 ± 0.3% and 3.7 ± 0.5% and liquid
production factors of 0.5 ± 0.1% and 0.7 ± 0.1% (% N-oxidized) at 10 and 20 ºC were
obtained, respectively. Hence, the higher the temperature was, the higher the N2O production
by the nitrifying sludge was. The reasons why high temperatures favoured the N2O emissions
remained unclear, but different hypothesis were suggested such as the accumulation of
hydroxylamine or the enhancing of the nitrifier denitrification pathway caused by the lower
oxygen penetration into the granules at high temperature compared to low temperature.
![Page 85: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/85.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
62
![Page 86: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/86.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
63
6.1. INTRODUCTION
The implementation of the autotrophic biological nitrogen removal (BNR) in the
mainstream has been proposed as the most promising solution for achieving energy-neutral or
even energy-positive urban wastewater treatment plants (WWTPs) (Kartal et al., 2010;
Siegrist et al., 2008). Significant efforts have been made to implement such a treatment as a
one-stage system, where partial nitritation and anammox process (PN/A) are integrated in one
single reactor (De Clippeleir et al., 2013; Gilbert et al., 2014; Lotti et al., 2014a; Wang et al.,
2016a; Wett et al., 2013). This is based on the practise of implementing this processes for
sidestream treatment (Lackner et al., 2014). However the different conditions of low required
effluent concentrations, lower temperature and much larger hydraulic loading relative to
nitrogen loading might make a different process design more feasible. Two-stage systems
have been reported as a successful alternative to face the challenges of efficient autotrophic
BNR at mainstream conditions (Isanta et al., 2015a; Ma et al., 2011; Pérez et al., 2015).
In the race to achieve a sustainable urban WWTP not only the energy requirements
have to be considered but also the environmental impact of the facility. Thus, greenhouse
gases emissions of the wastewater treatment are a key-factor to pay attention to (Kampschreur
et al., 2009). Nitrous oxide (N2O) is produced in conventional urban WWTPs during the
autotrophic nitrification and heterotrophic denitrification and, actually, N2O emissions can
dominate the total greenhouse gases emissions from biological wastewater treatment
(Wunderlin et al., 2012). N2O is an important greenhouse gas with a global warming potential
of about 300 times higher than CO2 on a 100 year time horizon (IPCC, 2013) and a substantial
ozone-depleting compound in the stratosphere. Hence, mitigation strategies and control of
emissions is an essential issue to consider in the implementation of the autotrophic BNR in
the mainstream of urban WWTPs.
It is well known that N2O production in WWTPs is associated to nitrification by
ammonia oxidizing bacteria (AOB) and to denitrification by heterotrophic bacteria
(Kampschreur et al., 2009; Wunderlin et al., 2012). Furthermore, N2O emissions can be also
produced by abiotic chemical reactions (Harper et al., 2015; Kampschreur et al., 2011; Soler-
Jofra et al., 2016). AOB produce N2O by two different pathways: (i) from intermediates of the
biological oxidation of hydroxylamine (NH2OH), which is an intermediate during the
ammonia oxidation until nitrite and (ii) the nitrifier denitrification pathway, which is the
reduction of nitrite to N2O with ammonia, hydrogen or pyruvate as possible electron donors
![Page 87: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/87.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
64
(Wunderlin et al., 2012). Heterotrophic denitrifiers produce N2O as intermediate in the
denitrification so it can be released due to an imbalanced metabolic activity, a nitrite
accumulation or a limited availability of biodegradable organic compounds and incomplete
denitrification (Kampschreur et al., 2009; Wunderlin et al., 2012).
In the autotrophic BNR process, N2O emissions will mainly occur in the partial
nitritation step since anammox bacteria are not supposed to produce N2O as it is not involved
in the anammox metabolism (Kartal et al., 2011). Actually, very low N2O emissions were
reported in anammox reactors and they were associated to side reactions independent of
anammox bacteria (Lotti et al., 2014c), or to abiotic reactions (Kampschreur et al., 2011). In
recent years, N2O gas emissions were widely studied for partial PN/A systems (either in one-
stage systems or in a single partial nitritation reactor) treating high-strength nitrogen
wastewaters, mainly reject water (Castro-Barros et al., 2015; Desloover et al., 2011;
Kampschreur et al., 2008; Mampaey et al., 2016; Okabe et al., 2011; Pijuan et al., 2014).
There was a huge variability on N2O emissions values reported in literature, ranging from
1.5% (Rathnayake et al., 2013) to 11% (Desloover et al., 2011) of the ammonium oxidized
emitted as N2O. This variability was due to differences in reactor configurations, type of
influent, conditions applied and even the methodology used for quantifying emissions (Bollon
et al., 2016). In the case of PN/A systems at mainstream conditions, to the best of the author’s
knowledge, only Wang et al. (2016b) and Reino et al. (2016) reported N2O gas emissions of a
nitritation reactor treating a low-strength synthetic influent. Reino et al. (2016) reported very
low values (0.36 ± 0.07% of the ammonium oxidized) in a granular sludge reactor performing
partial nitritation at 10 °C, compared to N2O gas emissions reported by Pijuan et al. (2014)
(6% of the ammonium oxidized) which used the same control strategy but treating a reject
water at 30 °C, and it was suggested that temperature could be an important factor affecting
N2O emissions.
The effect of temperature on N2O emissions was never deeply studied since, as
mentioned before, most studies were performed for systems treating reject water, which is
characterized by a high temperature (30–35 °C). However, wastewater temperature is a key
parameter in the nitrification process which affects to mass transfer, chemical equilibrium and
growth rate (Van Hulle et al., 2010), so it could be also an important parameter affecting N2O
emissions. Furthermore, N2O solubility decreases when temperature increases which affects
N2O stripping from wastewater to gas phase resulting in the enhancement of N2O gas
emissions.
![Page 88: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/88.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
65
Hence, the objective of the present study was to investigate the effect of temperature
on the N2O gas emissions from a granular sludge airlift reactor performing partial nitritation
of a low-strength synthetic influent. Hereto, the reactor was operated at three different
temperatures: 10, 15 and 20 °C.
6.2. MATERIALS AND METHODS
6.2.1. Configuration and operation phases of the reactor
A lab-scale granular sludge airlift reactor with a working volume of 1.5 L was used.
The downcomer-to-separator diameter was 0.57 and the total length-to-downcomer diameter
ratio was 8 (Fig. 6.1). Compressed air was supplied through an air diffuser placed at the
bottom of the reactor and was manually manipulated to maintain the dissolved oxygen (DO)
concentration in the bulk liquid in 1.6 ± 0.4 mg O2 L-1. The DO was measured online by
means of a DO electrode (Mettler Toledo, USA) and the pH was controlled and maintained at
8.0 ± 0.1 by the addition of 0.5M Na2CO3. DO monitoring and pH control was done by a
biocontroller (ADI 1030, Applikon, The Netherlands). The reactor temperature was controlled
by means of a cryostat connected to the jacket of the reactor.
Continuous operation of the reactor was divided in four different periods. The period I
(days 0–7) corresponded to the start-up period when the nitrogen loading rate (NLR) was
increased until achieving an average value in period II (days 8–40). Periods II, III (days 41–
58) and IV (days 59–65) corresponded to the stable reactor operation at the different
temperatures studied: period II at 10 ºC, period III at 20 ºC and period IV at 15 ºC. During the
transition between these periods temperature was directly changed. The sequence of
temperatures tested was not consecutive (from the lowest temperature to the highest
temperature) to minimize the effect of changing conditions on the possible increase of N2O
emissions.
6.2.2. Inoculum and influent characteristics
The airlift reactor was inoculated with 1L of granular sludge (approximately 2 g VSS)
from a granular sludge reactor operated in the long-term performing partial nitritation of a
low-strength synthetic wastewater at 10 ºC (Reino et al., 2016). The operational
![Page 89: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/89.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
66
characteristics of the granular reactor at the moment when the inoculum was withdrawn are
shown in Table 6.1. The inoculum was highly enriched in ammonia oxidizing bacteria (AOB)
with more than 90% of abundance of AOB and 1 ± 1% of NOB (specifically Nitrobacter spp.)
quantified through fluorescence in situ hybridization (FISH). Nitrospira spp. (NOB-type
bacteria) were not detected in the inoculum.
Fig. 6.1. Image of the airlift reactor and (A) and schematic diagram of the reactor set-up
showing the peripheral instrumentation and control loops (B). DO: dissolved oxygen.
The granular airlift reactor was fed with a synthetic influent mimicking the pretreated
municipal wastewater coming from the mixture of the effluent of a previous A-stage plus the
recirculation of the reject water of the digested sludge, as in an anammox-based WWTP
(Isanta et al., 2015a; Kartal et al., 2010). The resulting influent contained, in average, 70 mg
N-NH4+ L-1, 45 mg KH2PO4 L-1, 784 mg NaHCO3 L-1, 80 mg NaCl L-1, 40 mg CaCl2 L-1, 90
mg MgCl2 L-1 and 1 mL of trace elements solution per L of influent consisting of 1.5 g
FeCl3.6H2O L-1, 0.18 g KI L-1, 0.15 g CoCl2.6H2O L-1, 0.12 g ZnSO4.7H2O L-1, 0.12 g
MnCl2.4H2O L-1, 0.06 g Na2MoO4.2H2O L-1, 0.03 g CuSO4.5H2O L-1 and 10 g EDTA L-1.
![Page 90: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/90.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
67
6.2.3. Specific analytical methods and N2O measurements
Concentrations of ammonium, nitrite and nitrate in influent and effluent were regularly
measured off-line with Dr. Lange test kits (Hach Lange, Germany) in previously filtered (0.22
μm pore) samples.
Measurements of N2O concentration in the off-gas were analysed by means of an
online analyser (Emerson Rosemount NGA 2000). Off-gas was collected continuously from
the reactor headspace and conducted via a gas tube to the online analyser. A moisture filter
was installed at the gas inlet of the analyser and a t-shaped tubing joint was fitted on the gas
tube connecting the gas outlet of the reactor and the gas analyser, allowing the excess of gas
to escape and thus avoiding overpressure in the line. Data were logged every minute for a
period of at least 4 hours for each test. In period II (10 °C), two sets of tests were done: (i)
during days 17, 18 and 21 of operation, and (ii) during days 30, 31, 32 and 33 of operation. In
period III (20 °C) the N2O measurements were performed during days 44, 56 and 57. And
finally, in period IV (15 °C) measurements were performed during days 63 and 64 of
operation.
Table 6.1. Operational characteristics of the granular sludge airlift reactor which provided the
inoculum of the granular sludge airlift reactor of the present study. (NLR = Nitrogen Loading
Rate; NRR = Nitrogen Removal Rate; sNLR = specific Nitrogen Removal Rate)
Parameter Value Units
Volume 5.2 L
Temperature 10 °C
Dissolved Oxygen 1.3 ± 0.5 g L-1
pH 8.0 ± 0.1
NLR 0.63 ± 0.06 g N L-1 d-1
AOR 0.34 ± 0.06 g N L-1 d-1
sNLR 0.18 ± 0.03 g N g-1 VSS d-1
[N-NH4+]effluent 31 ± 4 g N-NH4
+ L-1
[N-NO2-]effluent 35 ± 4 g N-NO2
- L-1
[N-NO3-]effluent 0.6 ± 0. 3 g N-NO3
- L-1
![Page 91: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/91.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
68
6.2.4. Calculation of the N2O production factors
Two different N2O production factors were calculated. One was based on the total
amount of N2O produced in relation to the total ammonium oxidized to nitrite, and the other
one was based on the total amount of N2O produced in relation to the total ammonium of the
influent. The way of calculating the N2O production factors is important to compare different
nitrifying systems since, as explained by Pijuan et al. (2014), the production factor relative to
the total ammonium oxidized to nitrite is the most adequate factor to compare the N2O
production when the reactor is oxidizing only a certain fraction of the ammonium load (e.g.
either full or partial nitritation).
Moreover, in the present study N2O production factors were also divided in: N2O gas
emission factors and N2O liquid production factors, depending on the phase where N2O was
present. The N2O emitted in the gas phase was quantified with N2O gas emission factors
(EFgas), while the dissolved N2O in the reactor bulk liquid was quantified with N2O liquid
production factor (PFliq). Finally, a total N2O production factor (PFtot), comprising production
in both gas and liquid phases, was calculated by the sum of the EFgas and PFliq. All the
calculations used are described below:
= + (Eq. 6.1)
( ) = [ − ] ×
[ − ] × × 100 (Eq. 6.2)
( ) = [ − ] ×
[ − ] × × 100 (Eq. 6.3)
( ℎ ) = [ − ] ×
[ − ] × × 100 (Eq. 6.4)
( ℎ ) = [ − ] ×
[ − ] × × 100 (Eq. 6.5)
where,
![Page 92: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/92.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
69
[ − ] ( − · )
= [ − ]( ) × ( ) × 28( · )
0.082 ·· × ( ) × 1000
(Eq. 6.6)
[ − ] ( − · ) = − ℎ
[ − ] ( − · )
= [ − ] − [ − ]
(Eq. 6.7)
( · ) = ℎ
( · ) = ℎ
[ − ]
6.2.4.1
6.2.4.1. Calculation of the N2O liquid concentration
Concentration of N2O in the liquid was estimated based on the mass transfer
coefficient and the maximum solubility of N2O at the system conditions, by using
the equation Eq. 6.8. was calculated with the equation Eq. 6.9 according to the
Higbie’s penetration model as described in Marques et al. (2016) and values obtained are
presented in Table 6.2.
= × [ − ] − [ − ]∗ (Eq. 6.8)
= × ,
, (Eq. 6.9)
where,
![Page 93: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/93.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
70
( − · · )
=[ − ] ( − ) ∙ ( )
( )
(Eq. 6.10)
[ − ] ( − · ) = − ℎ
[ − ] ( − · ) = − ℎ −
[ − ]∗ ( − · )
= [ − ] ( − · ) ∙
(Eq. 6.11)
, ( · ) = ( 6.2)
, ( · ) = ( 6.2)
( ) =
( ) = ℎ
( ) = ( 6.2)
The mass transfer coefficient for oxygen was calculated based on the oxygen
uptake rate (OUR) and the DO concentration in the bulk liquid of the granular airlift reactor
as described by equation Eq. 6.12. OUR was calculated based on the stoichiometric oxygen
requirement for the oxidation of ammonium by AOB and the production of nitrate by NOB.
= × [ ]∗ − [ ] (Eq. 6.12)
where,
[ ]∗ ( · ) = [ ] ( · ) ∙ (Eq. 6.13)
![Page 94: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/94.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
71
[ ] ( · ) = in the air used for aeration
Table 6.2. Main parameters used for the determination of the concentration of N2O in the
bulk liquid for the three temperatures of operation of the granular sludge airlift reactor.
Temperature Henry’s constant
O21
Henry’s constant
N2O1 ,
2 ,
3
(°C) (mol m-3 Pa-1) (d-1) (cm2 s-1) (d-1)
10 3.81·10-4 1.70·10-5 76 ± 6 1.60·10-5 1.27·10-5 68 ± 5
15 3.25·10-4 1.55·10-5 97 ± 28 1.80·10-5 1.28·10-5 82 ± 25
20 2.78·10-4 1.42·10-5 146 ± 8 1.98·10-5 1.27·10-5 117 ± 7
*References: 1(Sander, 2015); 2(Ferrell and Himmelblau, 1967) and 3(Tamimi et al., 1994).
6.2.5. Fluorescence in situ hybridization (FISH)
Abundances of AOB and NOB were analysed by FISH technique at the beginning
(day 0) and at the ending of the operation (day 61). Specific probes for AOB and NOB
(specifically Nitrobacter spp.) were 5’-Cy3-labeled and 5’-Fluos-labeled, respectively.
Hybridizations were performed with the specific and general (5’-Cy5-labeled) probes
described in Section 4.3.1 of Chapter 4. The general probe for all microorganisms was 5’-
Cy5-labeled. Hybridization protocol was performed according to Section 4.3.1, Chapter 4.
Slides were observed with an epifluorescence microscope (Axioplan 2; Zeiss), and image
acquisition was performed with a Leica D350F camera.
6.3. RESULTS AND DISCUSSION
6.3.1. Operation of the reactor
The airlift reactor was inoculated with granular sludge from another granular sludge
airlift reactor which performed stable partial nitritation of a low-strength influent for 250 days
![Page 95: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/95.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
72
at 10 ºC. More details about this operation can be found in Chapter 5. The operation of the
granular sludge airlift reactor in the present study was divided in four periods (Fig. 6.2).
Continuous operation took place from the start (inoculation at day 0) with an initial nitrogen
loading rate (NLR) of 0.21 ± 0.03 g N L-1 d-1 and a temperature of 10 ºC. During the period I
or start-up period (days 0–7), the NLR was gradually increased until achieving an average
NLR of 0.60 ± 0.07 g N L-1 d-1 in period II (days 8–40). From day 15 onwards the nitrate
concentration in the effluent started to increase and nitrite concentration decreased. This
meant that nitratation activity developed in the granular airlift reactor despite of maintaining a
low DO/TAN concentrations ratio (0.06 ± 0.02 mg O2 mg-1 N during periods I and II) which
was previously reported to maintain stable partial nitritation with efficient NOB repression in
granular systems (Bartrolí et al., 2010; Isanta et al., 2015a). Table 6.3 shows the average
concentrations of TAN, TNN and nitrate in the effluent of the airlift reactor during the
different periods of operation. Nitrite and nitrate concentrations stabilized at the end of period
II (days 30–40) at 10 °C with effluent values of 6 ± 2 mg N-NO2- L-1 and 11 ± 4 mg N-NO3
-
L-1, between these days. In period III (days 41–58) temperature was increased until 20 ºC and
stable operation was achieved with an average NLR of 0.78 ± 0.10 g N L-1 d-1. The
concentration of the different nitrogen species in the effluent was also maintained stable (Fig.
6.2B and Table 6.3), even when temperature was decreased again until 15 ºC in period IV
(days 59–65) and the NLR decreased until an average value of 0.72 ± 0.08 g N L-1 d-1.
Specific nitrogen removal rate (sNLR) increased from 0.31 ± 0.04 g N g-1 VSS d-1 in period II
(10 ºC) until 0.40 ± 0.06 g N g-1 VSS d-1 in period III (20 ºC), which was expected since
biomass activity increase with temperature.
Biomass concentration in the reactor was maintained stable during the four different
periods of operation and resulted in 1.9 ± 0.2 g VSS L-1. Settling properties of the granules
were also maintained during the whole operation of the granular airlift reactor, with an
average settling velocity of 23 ± 5 m h-1 and an average SVI of 76 ± 4 ml g-1 SST, which are
typical values of granular biomass (an image of the nitrifying granules is depicted in Fig. 6.3).
The hydraulic retention time (HRT) was maintained at 2.4 ± 0.5 hours and the solid retention
time (SRT) was kept at an average value of 23 ± 10 days.
![Page 96: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/96.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
73
Fig. 6.2 Continuous operation of the granular sludge airlift reactor treating a low-strength
synthetic influent at different temperatures. Operation was divided in four different periods:
period I (start-up), period II (operation at 10 °C), period III (operation at 20 °C) and period IV
(operation at 15 °C). (A) Nitrogen Loading Rate (NLR), Nitrogen Removal Rate (NRR) and
temperature (T); (B) Nitrogen compounds concentrations throughout the operation of the
granular sludge reactor.
Tem
pera
ture
(ºC
)
5
10
15
20
25N
LR a
nd N
RR
(g N
L-1
d-1
)
0.0
0.2
0.4
0.6
0.8
1.0TNLRNRR
Time (days)0 5 10 15 20 25 30 35 40 45 50 55 60 65
N-s
peci
es (m
g N
L-1
)
0
10
20
30
40
50
60
70
[N-NH4+] effluent
[N-NO2-] effluent
N-NO3- effluent
I II III IVA
B
![Page 97: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/97.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
74
Table 6.3. Nitrogen loading rate (NLR) achieved and concentration of the nitrogen species
present in the effluent during the different periods of operation of the granular sludge airlift
reactor. n.a.: not analysed.
Period Temperature NLR [TAN]eff [TNN]eff [N-NO3-]eff
(°C) (g N L-1 d-1) (mg N L-1) (mg N L-1) (mg N L-1)
I 10 0.23–0.56 25 ± 10 42 ± 10 n.a.
II 10 0.60 ± 0.07 38 ± 9 18 ± 10 6 ± 4
III 20 0.78 ± 0.10 35 ± 9 14 ± 7 14 ± 2
IV 15 0.72 ± 0.08 38 ± 8 15 ± 3 12 ± 4
Fig. 6.3. Image of the granules of the granular sludge airlift reactor.
The measured nitrogen compounds balanced well during the whole operation of the
reactor, with an average value of 99 ± 6% detection of the nitrogen load from the influent in
the effluent (Fig. 6.4). Thus, neither heterotrophic nor autotrophic (anammox process)
denitrification was considered to take place in the granular sludge airlift reactor, and
consequently the contribution of heterotrophic denitrification to N2O emissions can be
neglected.
![Page 98: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/98.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
75
Figure 6.4. Fulfillment of the nitrogen balance during the operation of the granular sludge airlift reactor treating synthetic low-strength wastewater.
6.1.1. Microbial characterization of the granular sludge
Biomass samples from days 0 and 61 were analysed by FISH technique to assess the
enrichment in AOB in the granular sludge during the whole operation of the reactor.
Qualitative evaluation of the results of FISH indicated that granules were composed
predominantly by AOB while Nitrobacter spp. (NOB-type bacteria) were not detected, as
shown in Fig. 6.5. NOB were not detected even at the end of the operation, when about 10 mg
N-NO3- L-1 were produced in the reactor. Reasons why the stability of nitritation was lost
remained unclear. The presence of Nitrospira spp. (NOB-type bacteria) could explain the
nitratation activity developed in the granular airlift reactor, however Nitrospira spp. were
never detected by FISH throughout the operation of the reactor.
Time (days)
0 5 10 15 20 25 30 35 40 45 50 55 60 65
N-B
alan
ce fu
lfillm
ent (
%)
80
90
100
110
120
PeriodI
PeriodII
PeriodIII
PeriodIV
![Page 99: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/99.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
76
Fig. 6.5. FISH analysis performed on the granular sludge depicting AOB (red) and NOB
(green) over the universal probe (blue) on A) day 0 and B) day 61 of operation.
6.1.2. Nitrous oxide production
Off-gas was monitored during the periods II, III and IV of operation of the granular
sludge airlift reactor in order to calculate the N2O gas emission factors (EFgas) of the nitrifying
sludge at different temperatures. During these three periods, the operation was maintained
stable with average ammonium, nitrite and nitrate concentrations of 37 ± 8 mg N-NH4+, 19 ±
9 mg N-NO2- and 10 ± 5 mg N-NO3
-. DO concentration was stable (1.6 ± 0.4 mg O2 L-1)
during these periods to avoid a strong influence on the N2O production as previously reported
by Pijuan et al. (2014). Since the granular sludge airlift reactor operated performing partial
nitritation, a discussion of the nitrous oxide emission factors based on the N2O emitted in
relation to the total ammonium oxidized by AOB is more appropriate.
Table 6.4 shows the N2O gas emission factors obtained during the operation of the
granular sludge airlift reactor at 10, 15 and 20 ºC. A 3-times increase was measured in N2O
gas emissions when temperature increased from 10 to 20 ºC in period III. It could be argued
that after a long period operating at 10 ºC there is an acclimation of the biomass at that
temperature, and changing the operation at higher temperature acted as a disturbance
triggering higher N2O emissions. Nevertheless, N2O gas measurements were performed at the
beginning and end of the period III and no diminishment in emissions after operating at 20 °C
was observed (Fig. 6.6). In addition, a decrease in N2O EFgas was observed when temperature
decreased again until 15 ºC in period IV, reaching roughly the same value obtained for 10ºC.
![Page 100: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/100.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
77
Table 6.4. N2O gas emission factors (EFgas) from the granular sludge airlift reactor treating a
low-strength influent at different temperatures. DO was maintained in 1.6 ± 0.4 mg O2 L-1
during all the N2O measurements.
Period Days T (°C)
Gas flow (L h-1)
EFgas
(% of N-influent) EFgas
(% of N-oxidized)
II 8–40 10 2.9 ± 0.2 0.6 ± 0.2 1.5 ± 0.3
III 41-58 20 4.6 ± 0.7 1.9 ± 0.6 3.7 ± 0.5
IV 59-65 15 2.4 ± 0.3 0.5 ± 0.2 1.5 ± 0.5
Figure 6.6. N2O production factors relative to the ammonium oxidized to nitrite during the
operation of the granular airlift reactor at 10, 15 and 20 °C. DO was maintained in 1.6 ± 0.4
mg O2 L-1 during all the N2O measurements. EFgas: N2O gas emission factors; PFliq: N2O
liquid production factors; PFtot: N2O total N2O production factors.
Hence, a clear increase of N2O gas emissions was found for temperatures higher than
15 °C. Two reasons could explain this trend: (i) high temperature led to high N2O production
in the granular sludge airlift reactor or (ii) N2O gas emissions increased because of the
Time (days)
0 5 10 15 20 25 30 35 40 45 50 55 60 65
Tem
pera
ture
(ºC
)
8
10
12
14
16
18
20
22
PF
(% o
f N-O
xidi
zed)
0
1
2
3
4
5
6
TemperatureEFgasPFliqPFtot
PeriodI
PeriodII
PeriodIII
PeriodIV
![Page 101: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/101.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
78
increment of stripping of N2O, since aeration was not constant during the three periods, being
the highest aeration at 20 °C (Table 6.4).
To distinguish between the increment of N2O emissions due to the increment of the
production or due to the increment of the stripping, the N2O liquid production factors (PFliq)
were calculated. Fig. 6.7 shows both gas and liquid N2O production factors at different
temperatures, together with the total production factors calculated as the sum of both
contributions (liquid and gas).
Fig. 6.7 shows that PFliq increased when temperature decreased despite of N2O
solubility decreases with temperature. N2O is a very soluble gas (solubility: 1260 mg L-1 at 20
°C, (Weiss and Price, 1980)) and, actually, N2O concentrations in the liquid phase were
always higher than in the gas phase, and, in addition, increased when temperature increased
(Table 6.5) despite of N2O solubility decreases with temperature. Furthermore, both PFliq and
EFgas slightly increased from 10 °C to 15 °C although gas flow decreased (gas flow of 2.9 ±
0.2 L h-1 at 10°C and 2.4 ± 0.3 L h-1 at 15 °C). These observations indicated that EFgas
increased not only because of the stripping but also because of an increase in the production
when temperature was increased.
Fig. 6.7. N2O production factors relative to the total NH4+ oxidized to NO2
- at different
temperatures. EF gas: N2O gas emission factor; PF liq: N2O liquid production factor; PF total:
sum of liquid and gas N2O production factors; T10, T15 and T20: operation at 10, 15 and 20
°C, respectively.
PF total(%) EF gas(%) PF liq(%)
Pro
duct
ion
fact
or(%
of N
-oxi
dize
d)
0
1
2
3
4
5
6T10 T15 T20
![Page 102: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/102.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
79
Table 6.5. Concentrations of N2O in the off-gas and liquid phase during the different periods
of the operation of the granular sludge airlift reactor. Concentration in the off-gas was directly
measured in the reactor, while the concentration in the liquid was calculated as explained in
the materials and methods section.
Period Days T (°C)
[N-N2O] in the off-gas (mg L-1)
[N-N2O] in the liquid (mg L-1)
II 8–40 10 0.08 ± 0.01 0.12 ± 0.02
III 41-58 20 0.18 ± 0.01 0.24 ± 0.03
IV 59-65 15 0.09 ± 0.02 0.11 ± 0.04
The difference in N2O production found at 20, 15 and 10 °C in the reactor suggests
that there is a kinetic deactivation of N2O emissions at low temperatures. In this sense two
possible explanations for this observation were hypothesised: (i) the kinetic dependency with
temperature of the ammonia monooxygenase (AMO) enzyme catalysing the oxidation of
ammonium to hydroxylamine is different than that for the hydroxylamine oxidoreductase
(HAO) enzyme catalysing the oxidation of hydroxylamine to nitrite, in such a way that at 20
°C the intermediate hydroxylamine slightly accumulates because the oxidation of
hydroxylamine is the limiting step. However, at lower temperature, this situation would be
reversed, and the oxidation of hydroxylamine would be faster than the oxidation of ammonia.
The decrease in hydroxylamine accumulation could reduce considerably the N2O emissions
because hydroxylamine is the precursor of N2O in both pathways (hydroxylamine oxidation
and nitrifier denitrification) in granular sludge reactors performing partial nitritation (Sabba et
al., 2015). (ii) A second possibility to take into account is the temperature dependency of the
acid-base equilibrium ammonium-ammonia. The true substrate of AOB is ammonia rather
than ammonium (Suzuki et al., 1974). There is an impact of the temperature in the half-
saturation coefficient expressed in ammonium concentration units (Suzuki et al., 1974). Since
the residual ammonium concentration is kept rather constant among the different temperature
tests (37 ± 8 mg TAN L-1), the fraction of ammonia is significantly decreasing with the
decrease in temperature at a pH of the bulk of 8 (free ammonia concentration of 0.81, 1.2 and
1.7 mg NH3 L-1 at 10, 15 and 20 °C, respectively). Additionally, a gradient of pH is expected
in the biofilm, because ammonia oxidation produces protons (de Beer et al., 1993; Gieseke et
al., 2006; Schreiber et al., 2009) which will decrease even more the ammonia concentration in
![Page 103: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/103.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
80
the deeper layers of the granule. With the decrease in temperature if a good fraction of the
cells is not saturated in ammonia, the accumulation of hydroxylamine could decrease
considerably, and consequently, also the N2O production, as already discussed.
A third possible explanation which should not be overlooked is the effect of oxygen
concentration on the N2O emissions. It was mentioned before that DO concentration in the
bulk liquid was maintained stable during the three periods operating at different temperatures.
However, the oxygen penetration into the granules was expected to be different at different
temperatures: higher temperatures led to low oxygen penetration into the granules compared
to lower temperatures. Hence, a limiting DO concentration in the granule at high temperature
could be responsible of enhancing the nitrifier denitrifaction pathway of N2O production, and
thus increasing N2O emissions.
As previously discussed, N2O production at 20 °C, either in the gas phase or in the
liquid phase, was higher than production at the lower temperatures, being the gas phase
emissions the more affected, i.e. stripping was the main contributor to enhance N2O gas
emissions. Thus, lower aeration could be proposed to reduce N2O emissions at temperatures
higher than 15 °C. However, nitrifying activity increased with temperature and NLR was
increased to maintain the ammonium oxidation throughout the reactor operation. This
increase led to high oxygen consumption and, thus, a high aeration was needed to maintain
the DO concentration in the granular airlift reactor. If NLR was not increased, more
ammonium would be oxidized and effluent characteristics would be not maintained in the
reactor. The high gas flow needed to maintain the DO, together with the decrease in gas
solubility, increased the fraction of N2O stripped to the gas phase. In any case, if lower
aeration flowrates were used at temperatures higher than 15 °C to avoid the influence of
stripping, N2O gas emissions would be considerably reduced in the gas phase but maintained
in the same range in the liquid phase, which could transpose the emissions problem to the
effluent. Though, the reactor of partial nitritation is not the last reactor before effluent
discharge and N2O could be denitrified in a subsequent reactor resulting in an overall
emissions reduction.
The average values of N2O EFgas obtained for a granular sludge enriched in AOB were
in the same order of magnitude of other partial nitritation systems (Table 6.6). However, most
of the studies available in literature reported EFgas in partial nitritation systems treating high-
strength wastewater (e.g. reject water) and little has been published for partial nitritation of
![Page 104: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/104.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
81
low-strength wastewater (e.g. urban wastewater). Overall, Table 6.6 shows that nitritation
systems treating high-strength wastewater presented higher emission factors than the systems
treating low-strength influents, although there is a huge variability.
The effect of temperature on N2O production in a granular sludge enriched in AOB
performing partial nitritation has not been reported before. There are few studies that
characterize N2O emissions from full-scale nitrifying reactors, which present winter and
summer campaigns and, thus, high and low temperatures appear as a side parameter.
Nevertheless these studies were not specifically focused on the temperature and other side
parameters affected the emissions. On the one hand, Bollon et al. (2016) found that PFtot
(based on the N-oxidized) from full-scale nitrifying biofilters performing complete
nitrification were higher in the winter campaign (PFtot = 4.9 ± 0.5% at 15 °C) than in the
summer campaign (PFtot = 2.3 ± 0.5% at 22.5 °C), which contrasts with the results of the
present study. However, they suggested that the negative influence of temperature on
emissions was not related to the temperature itself, but to the low DO and high nitrite
concentrations occurred in winter, which enhance N2O production. In this sense, it could be
thought that the variations of the nitrite concentration in the granular airlift reactor of the
present study (Fig. 6.2) could affect N2O emissions, however the two sets of measurements on
period II were performed at different nitrite concentrations (days 17, 18, 21, 30, 31, 32 and 33
of operation, Fig. 6.6) and still they resulted in a very similar values (EFgas of 1.5 ± 0.3%). On
the other hand, Daelman et al. (2015) reported N2O emission factors in the long-term
operation of a full-scale urban WWTP and did not find any correlation with nitrous oxide
emissions and water temperature. In the same way, Ahn et al. (2010) did not directly
correlated temperature with N2O emissions from activated sludge processes of 12 WWTPs
across the United States, but expected that emissions were indirectly governed by temperature
trough manifestation in ammonium, nitrite or DO concentrations. In any case, the present
work is an interesting medium-term study to assess the N2O emissions in a partial nitritation
reactor at low temperature and to assess if there is an impact of the temperature in the
emission factors. Added value comparing to the values obtained in Reino et al. (2016) is that
online measurements were done for longer periods of time at different temperatures.
![Page 105: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/105.jpg)
Table 6.6. N2O gas emission factors (based on the nitrogen oxidized) for different systems performing partial nitritation in a single-reactor.
Influent Type of reactor EFgas
(% of N-oxidized)
DO Concentration
(mg O2 L-1) T (°C) Reference
Reject water Full-scale 7.4 2 30 Mampaey et al. (2016)
Reject water Full-scale 3.4 2.5 33 Kampschreur et al. (2008)
Reject water Pilot-scale 2.2–6.1 1.1–4.5 30 Pijuan et al. (2014)
Reject water Lab-scale 9.6 ± 3.2 1–2 35 Okabe et al. (2011)
Synthetic high-strength wastewater Lab-scale 1.5 ± 0.8 1.5–1.9 35 Rathnayake et al. (2013)
Real high-strength wastewater Full-scale 8–11 0.4–1 36 Desloover et al. (2011)
Synthetic Low-strength wastewater Lab-scale 1.3-3.3 0.3–3 22 Wang et al. (2016b)
Synthetic Low-strength wastewater Lab-scale 0.36 ± 0.07 1.3 ± 0.3 10 Reino et al. (2016)
Synthetic Low-strength wastewater Lab-scale 3.7 ± 0.5 1.6 ± 0.4 20 This study
Synthetic Low-strength wastewater Lab-scale 1.5 ± 0.3 1.6 ± 0.4 10 This study
![Page 106: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/106.jpg)
Chapter 6. Effect of temperature on N2O production from a highly enriched nitrifying granular sludge performing partial nitritation at mainstream conditions
83
6.2. CONCLUSIONS
A granular sludge airlift reactor performing partial nitritation at mainstream
conditions was operated at high NLR with low N2O emissions.
The production of N2O by an enriched nitrifying granular sludge at 10, 15 and 20 ºC
was determined, resulting the higher the temperature the higher the N2O production.
Temperatures of operation higher than 15 ºC caused a negative effect on the N2O
gas emissions due to a higher production but specially due to the higher stripping
occurred.
The accumulation of hydroxylamine at high temperature was suggested to be the
responsible of the increase of N2O production.
![Page 107: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/107.jpg)
84
![Page 108: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/108.jpg)
Chapter 7
DEVELOPMENT OF NITRATATION ACTIVITY AFTER
THE LONG-TERM STABLE PARTIAL NITRITATION OF
A LOW-STRENGTH WASTEWATER IN A GRANULAR
AIRLIFT REACTOR
![Page 109: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/109.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
86
![Page 110: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/110.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
87
Abstract
A stable long-term operation of the partial nitritation process at mainstream conditions
appears as a prerequisite for implementing a two-stage system for the autotrophic biological
nitrogen removal in the main water line of urban wastewater treatment plants. In the present
study, a lab-scale granular sludge airlift reactor was operated for 700 days performing partial
nitritation of a low-strength wastewater. Stable operation with efficient repression of
nitratation activity was achieved for 400 days at 10 °C, which less than 2 mg N-NO3- L-1
produced in the reactor. However, nitratation activity appeared from day 401 onwards with
periods ranging from stable to unstable operation at different temperatures and operational
conditions. Solid retention time (SRT) was demonstrated to be a key parameter to pay
attention to, because when the reactor was not purged, SRT achieved values as high as 600 ±
400 days, which led to the growth of anammox bacteria which contributed to a destabilization
of the partial nitritation. In addition, a biofilm with a high content of Nitrospira spp. (NOB-
type bacteria) developed in the wall of the riser of the airlift reactor leading to a complete
destabilization of the partial nitritation, which indicated the importance of the cleaning and
maintenance of the reactor walls.
![Page 111: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/111.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
88
![Page 112: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/112.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
89
7.1. INTRODUCTION
The implementation of the biological autotrophic nitrogen removal (BNR) process in
the main water line of urban wastewater treatment plants (WWTPs) can make these facilities
as energy-neutral or even energy-positive (Kartal et al., 2010; Siegrist et al., 2008). The
current interest on implementing a two-stage system for the autotrophic BNR process in the
mainstream of urban WWTPs (Ma et al., 2011; Pérez et al., 2015) appeared after the
unsuccessfully attempts of such implementation in one-stage systems. Most of one-stage
systems working at mainstream conditions showed the failure of partial nitritation in the long-
term operation due to the growth of nitrite oxidizing bacteria (NOB) (De Clippeleir et al.,
2013; Hu et al., 2013; Winkler et al., 2011); and even those systems which succeed on
achieving an effective NOB repression showed considerably low nitrogen conversion rates
(Gilbert et al., 2014; Laureni et al., 2016; Malovanyy et al., 2015).
A stable long-term operation of the partial nitritation with effective NOB repression
appears as a prerequisite for implementing a two-stage system for autotrophic BNR in the
main water line of urban WWTPs, and thus, it has been under continuous research (Isanta et
al., 2015a; Pérez et al., 2014; Wett et al., 2013). The main challenge was enhancing the
growth of ammonia oxidizing bacteria (AOB) in detriment of the growth of NOB at
mainstream conditions (low temperature and low nitrogen concentrations), however NOB are
reported to grow faster than AOB at temperatures lower than 25 °C (Hellinga et al., 1998).
Operational parameters such as pH, temperature, free ammonia and free nitrous acid
concentrations, sludge retention time (SRT) and dissolved oxygen (DO) concentration affect
to the kinetics of AOB and NOB (Van Hulle et al., 2010), and thus, different strategies based
on these parameters or combinations thereof have been applied to favour AOB over NOB at
mainstream conditions. On the one hand, strategies based on the free ammonia and free
nitrous acid inhibitions were often difficult to apply due to the low nitrogen concentrations
typical of mainstream. Still, Wang et al. (2016a) recently reported a NOB repression strategy
which combined the sludge treatment using free nitrous acid with the DO control in a
nitritation reactor treating a low-strength wastewater. On the other hand, it was generally
known that NOB spp. present higher oxygen affinity than AOB spp. (Sin et al., 2008) and
strategies based on the application of low concentrations of DO in the bulk liquid were highly
used (Blackburne et al., 2008; Gilbert et al., 2014; Hu et al., 2013). However, it was recently
demonstrated that NOB (specifically Nitrospira spp.) presented higher oxygen affinity than
![Page 113: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/113.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
90
AOB (Regmi et al., 2014) and, thus, high DO concentrations should be applied instead in
systems presenting Nitrospira spp. to provide competitive advantage for AOB over NOB.
Likewise, Gao et al. (2014) proposed an aeration control strategy depending on the
temperature and ammonia concentration in the influent to effectively repress NOB at room
temperature (12–27 ºC) operating at DO concentrations as high as 2–7 mg L-1. Moreover,
despite of operating at DO concentrations higher than 1.5 mg L-1, Regmi et al. (2014) also
reported the use of an online aeration and SRT control strategy which guaranteed an operation
close to the critical AOB wash out and favoured NOB repression at mainstream conditions at
25 ºC. In this way, strategies based on limiting the overall SRT were also surmised, however
in some cases the SRT applied was too low (2.4 days in Blackburne et al. (2008); 3 days in
Ahn et al. (2008)) leading to a challenging implementation in practice, since the biomass
levels and reaction rates achieved could lead to a problematic real scale implementation. It
was also previously reported that stable partial nitritation was achieved if an adequate ratio
between DO and total ammonium concentrations (DO/TAN) in the bulk liquid was applied in
granular systems (Bartrolí et al., 2010; Isanta et al., 2015a; Jemaat et al., 2013). A low
DO/TAN ratio ensured oxygen limiting conditions and a residual concentration of ammonium
in the bulk liquid, which guaranteed the repression of NOB activity even at high DO
concentrations. Overall, either in one and two-stage systems, further study of the AOB and
NOB competition would be still needed to define the operational conditions that enable
effective NOB repression and stable partial nitritation in the long-term operation.
The aim of the present study was not exploring the competition between AOB and
NOB, but trying to explain the reasons why a previously successful partial nitritation achieved
at mainstream conditions (described in the Chapter 5 of this thesis) was destabilized. Stable
partial nitritation with efficient NOB repression was achieved in a granular sludge airlift
reactor treating a low-strength influent at 10 ºC and the operation successfully prevailed in the
long-term. However, nitratation activity appeared with apparently no reason. Thus, two main
objectives were defined: (i) study the reasons why the destabilization occurred and (ii)
explore how to avoid/confront such destabilization in a further real-scale implementation
perspective.
![Page 114: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/114.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
91
7.2. MATERIALS AND METHODS
7.2.1. Reactor set up and wastewater
A lab-scale airlift reactor with a total working volume of 5.2 L was used. The detailed
diagram of the reactor and set-up details are described in Section 4.1.1, Chapter 4.
Compressed air was supplied through an air diffuser placed at the bottom of the reactor and
was manually manipulated to maintain the DO concentration in the bulk liquid in the range
0.3–3.3 mg O2 L-1. The pH was measured on-line and automatically controlled at 8.0 ± 0.1 by
dosing a Na2CO3 0.5 M solution. The temperature was measured and controlled at different
set points depending on the experimental period: 10, 15, 20, 25 and 30 ºC. Total ammonia
nitrogen (TAN = N-NH4+ + N-NH3) and nitrate concentrations in the bulk liquid were
measured on-line. TAN concentration in the bulk liquid was automatically controlled by
varying the inflow rate by means of a proportional controller during the whole period of
operation.
The operation of the lab-scale airlift reactor last for almost two years and was divided
in three different periods, according to the stable or unstable operation. Thus, period I (days
0–400) corresponded to the stable operation performing partial nitritation at 10 °C (detailed
operation from day 0 to 250 is described in Chapter 5). Period II (days 401–540)
corresponded to the destabilization of partial nitritation and increase of nitratation activity.
Period III (541–700) corresponded to a brief recovery of the process followed by the
definitive destabilization of partial nitritation and further increase of nitratation activity.
7.2.2. Inoculum and influent characteristics
As previously described in Chapter 5, the initial biomass of the airlift reactor was
enriched in AOB and adapted to low temperature (12.5 ºC) in a reactor which was operating
for more than 400 days performing stable partial nitritation (Isanta et al., 2015a). The
inoculum contained around 81 ± 12% of AOB and 1 ± 1% of NOB as analysed by
fluorescence in situ hybridization (FISH).
The granular sludge airlift reactor treated a synthetic influent with an average TAN
concentration of 70 mg N L-1, which mimics a pretreated municipal wastewater coming from
the mixture of the effluent of a previous A-stage plus the recirculation of the reject water of
the digested sludge, as in an anammox-based WWTP (Isanta et al., 2015a; Kartal et al., 2010).
![Page 115: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/115.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
92
The synthetic influent also contained: 45 mg KH2PO4 L-1, 784 mg NaHCO3 L-1, 80 mg NaCl
L-1, 40 mg CaCl2 L-1, 90 mg MgCl2 L-1 and 1 mL of trace elements solution per L of influent
(Guerrero et al., 2011).
7.2.3. Anammox activity batch test
A batch test to determine the anammox activity was performed in the lab-scale airlift
reactor on day 603 (period III). First, influent flow was stopped and aeration was maintained
until TAN concentration was around 10 mg N-NH4+ L-1. Then (minute 98), air supply was
changed by nitrogen gas (N2) supply through the air diffuser placed at the bottom of the
reactor. When DO concentration was lower than 0.03 mg O2 L-1 a pulse of ammonium and
nitrite was done in a concentrations ratio adequate for anammox biomass (i.e. approximately
1.32 g N-NO2- g-1 N-NH4
+, Strous et al. (1998)). pH was maintained at 8 ± 0.3 by dosing
H2SO4 10% (v/v). Bulk liquid samples were periodically withdrawn from the reactor to
measure TAN, total nitrite nitrogen (TNN) and nitrate off-line. The batch test was finished
when TAN concentration was c.a. 10 mg N-NH4+ L-1.
The nitrite and ammonium consumption rates and nitrate production rate were
calculated from the slope of the plots depicting ammonium, nitrite and nitrate concentrations
versus time, respectively. Thus, the nitrite to ammonium consumption ratio and the nitrate
produced to ammonium consumed ratio were calculated by dividing the nitrite consumption
and nitrate production rates by the ammonium consumption rate.
7.2.4. Fluorescence in situ hybridization (FISH)
Abundances of AOB, NOB and anammox bacteria were analysed by FISH technique
coupled to confocal laser scanning microscopy (CLSM) as described in Section 4.3.1 of
Chapter 4. Regarding AOB, specific probes for Nitrosomonas spp. were 5’-6FAM-labeled
and 5’-ALEXA594-labeled. Regarding NOB, specific probes for Nitrobacter spp. were 5’-
Cy3-labeled and 5’-PacificBlue-labeled and a specific probe for Nitrospira spp. was 5’-
6FAM-labeled. For anammox bacteria, general anammox probes were 5’-ALEXA488-labeled
and 5’-Cy3-labeled. The different labelled probes were used depending on the different
populations analysed on each sample. Hybridization protocol and probes are fully described
in Section 4.3.1 of Chapter 4.
![Page 116: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/116.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
93
7.2.5. Specific analytical methods and calculations
TAN, TNN and nitrate concentrations were measured off-line according to Section
4.2.1, Chapter 4. These measured off-line values are the ones represented in the results
section. Sludge retention time (SRT) was calculated according to equation Eq. 5.2. described
in Section 5.2.4, Chapter 5.
The amount of nitrate theoretically produced by anammox was calculated according to
the anammox stoichiometry considering that 0.26 moles of nitrate are produced for each 1.02
moles of N2, as described by Strous et al. (1998). For calculating the N2, it was considered
that the nitrogen disbalance occurred in the granular airlift reactor was only due to the
production of N2 by anammox.
7.3. RESULTS AND DISCUSSION
7.3.1. Reactor operation
The lab-scale airlift reactor was operated for almost 2 years treating a low-strength
synthetic influent (Fig. 7.1). During period I (days 0–400) a stable partial nitritation at high
nitrogen loading rate (NLR = 0.59 ± 0.09 g N L-1 d-1) with effective NOB repression was
achieved at 10 ºC (operation between days 0 and 250 is more detailed in Chapter 5). Between
days 0 and 200 less than 1 mg N-NO3- L-1 was produced in the reactor and between days 201
and 400 only 2 ± 2 mg N-NO3- L-1 were produced in the bulk liquid of the granular sludge
airlift reactor. Furthermore, an adequate effluent for a subsequent anammox reactor was
achieved (1.1 ± 0.2 mg N-NO2- mg-1 N-NH4
+, Fig. 7.2). The success of such operation was
based on the maintenance of a low DO/TAN concentrations ratio in the bulk liquid (0.05 ±
0.04 mg O2 mg-1 N), which was previously reported to maintain stable partial nitritation in
granular systems (Bartrolí et al., 2010; Jemaat et al., 2013). Hence, DO/TAN concentrations
ratio was maintained at low values during the entire operation of the airlift reactor (Fig 7.2).
However, in period II (days 401–540) nitrate concentration increased while nitrite
concentration decreased in the bulk liquid. Nitrate accumulated until achieving very similar
values to those of nitrite concentrations. Since NOB were reported to show a more sensitive
temperature dependence than AOB (Hunik et al., 1994), temperature was increased on day
![Page 117: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/117.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
94
455 from 10 to 20 ºC to favour AOB over NOB with the aim of enhancing nitritation activity
in detriment of nitratation activity. Operation was maintained stable for some weeks, however
one month after the increase of temperature, the nitrate concentration sharply increased until
achieving a value of 30.7 mg N-NO3- L-1 and nitrite concentration resulted as low as 9.7 mg
N-NO2- L-1 on day 500. Nevertheless, on day 500 the abrupt increase stopped and nitrate
concentration was stabilized in 25 ± 3 mg N-NO3- L-1 for the next month. During period II,
DO/TAN concentrations ratio was considerably lower than the applied in the rest of the
operation (Fig. 7.2) but still the nitritation activity was the highest achieved.
Fig. 7.1. Long-term operation of the lab-scale granular airlift reactor treating a low strength
synthetic influent.
At the beginning of period III (days 541–700) temperature was directly increased from
20 to 30 °C with the aim of recovering the partial nitritation. It was reported that AOB growth
rate becomes higher than NOB growth rate at temperatures above 25 ºC (Hellinga et al., 1998;
Van Hulle et al., 2010). Actually, this is the principle used in the SHARON (Single reactor
High activity Ammonia Removal Over Nitrite) process, where a chemostat operated at high
temperature (30–40°C) and an appropriate SRT guarantees that AOB are maintained in the
reactor, while NOB are washed out (Hellinga et al., 1998). Hence, during the first month of
period III the partial nitritation was recovered and stabilized, with an immediate decrease of
Time (days)0 100 200 300 400 500 600 700
Tem
pera
ture
(ºC
)
5
10
15
20
25
30
35
N-S
peci
es (
mg
N L
-1)
0
20
40
60
80
[TAN] effluent[TNN] effluent[Nitrate] effluent
Period I Period II Period III
Temperature[TAN] influent
![Page 118: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/118.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
95
nitrate concentration once temperature increased to 30 °C and, in addition, with a nitrite to
ammonium (TNN/TAN) concentrations ratio adequate for a subsequent anammox reactor.
Fig. 7.2. Evolution of the dissolved oxygen concentration (A) and the DO/TAN and
TNN/TAN concentrations ratios (B) in the bulk liquid of the lab-scale airlift reactor during
the long-term operation treating a low-strength synthetic influent. DO: dissolved oxygen;
TAN: total ammonium nitrogen; TNN: total nitrite nitrogen.
On day 569, after the recovery of partial nitritation, an attempt of working at lower
temperature was made by decreasing the temperature from 30 to 25 °C. However, after one
week at 25 °C the nitrate rapidly increased and partial nitritation destabilized. For that reason,
temperature was increased again to 30 °C and a diminishment of nitrate concentration
occurred. Nevertheless, nitrite concentration did not increase and a partial nitritation with a
TNN/TAN concentrations ratio adequate for a subsequent anammox reactor was not
recovered this time. However, nitrate concentration was maintained stable in an average value
of 7 ± 2 mg N-NO3- L-1, so temperature was gradually lowered until achieving 10 °C on day
673 to evaluate if operation could be still maintained at low temperature. Nonetheless, nitrate
Time (days)0 100 200 300 400 500 600 700
TNN
/TA
N(m
g N
-NO
2- mg-1
N-N
H4+ )
0.0
0.5
1.0
1.5
2.0
DO
/TAN
(mg
O2 m
g-1 N
-NH
4+ )
0.00
0.04
0.08
0.12
TNN/TAN concentrations ratio in the effluentDO/TAN concentrations ratio in the bulk liquidTNN/TAN adequate for a subsequent anammox reactor
Period I Period II Period III
DO
Con
cent
ratio
n(m
g O
2 L-1
)
0.0
0.5
1.0
1.5
2.0
2.5
3.0A
B
![Page 119: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/119.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
96
concentration sharply increased while nitrite concentration decreased resulting in a complete
destabilization of the partial nitritation process.
Granules size was maintained stable during the entire operation of the airlift reactor,
with an average value of 700 ± 100 µm. Between days 50–500, the biomass concentration
was maintained stable with an average value of 3.3 ± 0.8 g VSS L-1, afterwards biomass
concentration decreased and it was maintained stable in 0.5 ± 0.1 g VSS L-1 from day 550
onwards. The decrease of biomass concentration was due to the biomass purge performed
from day 500 onwards.
7.3.2. Development of the nitratation activity
The airlift reactor was operated performing stable partial nitritation for 400 days at 10
°C (Fig. 7.1). Between days 0 and 200 nitrate production was barely detected, with less than 1
mg N-NO3- L-1 produced in the reactor, while between days 201 and 400 the production of
nitrate increased but maintained at an average value 2 ± 2 mg N-NO3- L-1. This successful
NOB repression was achieved by maintaining a very low DO/TAN concentrations ratio, i.e.
by imposing very strong oxygen limiting conditions in the bulk liquid of the reactor (Bartrolí
et al. 2010; Jemaat et al., 2013). Actually, it was the high residual TAN concentration (c.a. 31
mg N-NH4+ L-1, Fig. 7.1) rather than the DO concentration the reason why a low DO/TAN
concentrations ratio was maintained, as previously demonstrated in Isanta et al., (2015a). In
fact, the DO concentration continuously changed during the operation of the airlift reactor
(Fig. 7.2). Since DO/TAN was maintained during period I (Fig. 7.2), there should be another
reason for the slight increase of nitritation activity between days 201–400 compared to days
0–200; and also for the further destabilization of partial nitritation on period II.
7.3.2.1. Effect of solid retention time
Solid retention time (SRT) is an important parameter to consider in any
biological process, and even more with autotrophic microorganisms (e.g. nitrifying bacteria)
that are characterized by slow growth rates (Hunik, 1993). Thus, a high SRT is usually needed
to increase the biomass concentration in the system and guarantee the biomass growth. A high
SRT is guaranteed when granular sludge is used, so the exact value of SRT applied does not
receive as much attention as in other biological systems such as activated sludge systems.
However, in the nitritation process SRT is a parameter to pay attention to, since the NOB
wash out occurs if the SRT required for NOB growth is higher than the current SRT of the
![Page 120: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/120.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
97
system (Hellinga et al., 1998; Jubany et al., 2009b). This means that the NOB repression will
be achieved through a kinetic selection which favours AOB over NOB.
Fig. 7.3 shows the evolution of SRT during the long-term operation of the granular
sludge airlift reactor. The average value of SRT during period I was as high as 70 ± 30 days
and, moreover, it sharply increased in period II until 600 ± 400 days, i.e. SRT could be
considered as ∞. In period II the nitratation activity drastically increased in the granular airlift
reactor, once almost 6 times the SRT had past after the inoculation ((400 d)/(70 d-1) = 5.7).
So, it could be suggested that the development of the nitratation activity could be related to
the high SRT applied.
Fig. 7.3. Solid retention time versus the nitrate production in the long-term operation of the
lab-scale granular sludge airlift reactor.
In period I, a stable NOB repression was maintained in the reactor for 400 days,
despite of the high SRT applied (70 ± 30 days) which could be higher than the minimum SRT
needed for NOB growth. The applied SRT was much higher than the applied by Isanta et al.
(2015a) in the granular sludge airlift reactor which provided the inoculum of the present
study, where an effective NOB repression was achieved at 12.5 °C by also applying the
Time (days)0 100 200 300 400 500 600 700
Tem
pera
ture
(ºC
)0
5
10
15
20
25
30
35
N-N
O3- p
rodu
ced
(mg
L-1)
0
20
40
60
80
Solid
Ret
entio
n Ti
me
(day
s)
0
50
100550
600
650
TemperatureNitrate producedSRT
Period I Period II Period III
![Page 121: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/121.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
98
DO/TAN strategy but maintaining a SRT of 8 ± 3 days. Nevertheless, during period I
nitratation activity was barely detected in the reactor of the present study and it was only
started to be noticed during period II. This could be due to that such high SRT applied made
the nitratation activity more slowly noticeable and also to the strong effectiveness of the
system. Actually, nitratation activity appeared in period II after that almost 6 times the SRT
applied had past. As SRT continued being high and even drastically increased until a value
considered as ∞, the high nitratation activity continued increasing rather than stabilized (Fig.
7.3). Thus, although temperature was increased to favour AOB over NOB, the SRT of the
system was much higher than the minimum required for NOB and thus nitratation activity
was very high. Once SRT was decreased at the end of period II (by purging the reactor from
day 500 onwards), the nitrate concentration increase was stopped but maintained stable at
high values (25 ± 3 mg N-NO3- L-1). Then, temperature was increased to 30 °C, SRT was
maintained low (5 ± 4 days) and partial nitritation was recovered at the beginning of period
III. From day 500 onwards, SRT was maintained at 12 ± 12 days by periodically purging the
reactor and NOB repression was maintained when temperature was higher than 20 ºC.
However, stable partial nitritation with efficient NOB repression was not recovered when
temperature was lowered below 20 ºC, despite of using low DO/TAN values and low SRT. It
could be hypothesised that NOB developed inside of granules when high SRT were applied
and thus, even when purges were done in the airlift reactor, the NOB wash out was expected
to be very slow via biomass detachment. In fact, Isanta et al. (2015a) reported a slow NOB
wash out in a similar granular system where more than 300 days were needed for a decrease
of NOB population from c.a. 20% to 1%. Nevertheless, in the reported work an effective
NOB repression was achieved due to the application of the DO/TAN strategy even though
NOB were present in the sludge, so in the reactor of the present study the reason why
nitratation activity could not be repressed when SRT was lowered and DO/TAN ratio was
maintained low was still unclear.
The importance of SRT in the competition of AOB versus NOB was reported before,
although mainly in activated sludge systems. For instance, Ahn et al. (2008) achieved stable
partial nitritation by a selective wash out of NOB through the combination of oxygen
limitation, free ammonia inhibition and operation at a NOB limiting SRT of 3 days. However,
an increase in SRT destabilized the partial nitritation. In addition, Jubany et al. (2009b)
calculated the different SRT required for NOB growth under different conditions applied in a
system treating reject water at 25 °C. The reported study achieved effective NOB wash out at
![Page 122: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/122.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
99
operation SRT of 30 days, demonstrating that a high SRT was not the key factor for NOB
proliferation, but the different strategies applied were. Thus, an efficient NOB repression is
possible at high SRT but with the adequate repression strategies, since the minimum SRT
required for NOB growth changes for each specific case. In the present study the minimum
SRT required for NOB growth was unknown since specific kinetic experiments should be
done to calculate it.
In any case, two related implications could be extracted: (i) in addition to the
DO/TAN strategy applied, the effect of SRT should not be overlooked in the system, and (ii)
the importance of purging the system should be pointed out, although the NOB wash out is
expected to be slow if NOB already developed inside the granule.
7.3.2.2. Growth of anammox bacteria
After recovering the stable partial nitritation at the beginning of period III by
maintaining an adequate SRT (5 ± 4 days) at 30 °C, temperature was lowered to 25 °C, since
at such temperature AOB growth was expected to be higher than NOB (Hellinga et al., 1998;
Van Hulle et al., 2010). Nevertheless, after one week operating at 25 °C, nitrate accumulated
in the reactor and temperature was increased again to 30 °C. Then, nitrate concentration
decreased in the bulk liquid; however, this decreased was not associated to an increase of
nitrite concentration, appearing a nitrogen disbalance in the reactor (Fig. 7.4).
Fig. 7.4. Nitrogen balance fulfilment during the operation of the lab-scale airlift reactor
treating a synthetic low-strength influent.
Time (days)0 100 200 300 400 500 600 700
N-B
alan
ce F
ulfil
lmen
t (%
)
40
60
80
100
120Period I Period II Period III
![Page 123: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/123.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
100
Overall, nitrogen balance was fulfilled during period I of operation, with an average
value of 96 ± 6% and it was slightly unfulfilled in periods II, with an average value of 93 ±
9%. But the nitrogen balance was clearly unfulfilled during the operation on period III, more
specifically between days 584–673 when the average value was 69 ± 4%. Therefore, the
presence of anammox bacteria in the granular sludge of the anammox reactor was expected.
A batch test with anammox substrates (ammonium and nitrite) in the bulk liquid
devoid of oxygen was performed on day 603 to evaluate the presence of anammox bacteria in
the granular sludge airlift reactor (see details in Section 7.2.3). Fig. 7.5 shows the evolution of
ammonium, nitrite and nitrate during the essay. On minute 98, the influent pump was stopped
and a pulse of anammox substrates was done in the bulk liquid previously flushed with N2 as
explained in Section 7.2.3. The high consumption of ammonium and nitrite was not explained
by the activity of AOB and NOB microorganisms since DO concentration was maintained
below 0.3 mg O2 L-1. Furthermore, the nitrite to ammonium consumption and nitrate
production to ammonium consumption ratios obtained (1.03 ± 0.07 and 0.22 ± 0.07,
respectively) were close to the anammox stoichiometry (Lotti et al., 2014c; Strous et al.,
1998). Hence, anammox bacteria developed in the granular sludge of the airlift reactor. This
fact could be expected because: (i) DO concentration was considerably low during period II
(Fig. 7.2) and, thus, the gradient of oxygen inside the granules could lead to an anoxic zone in
the granule where the anammox bacteria developed, such as in the CANON process; (ii) the
increase of temperature to 30 °C favoured anammox growth since optimal temperatures for
anammox were reported to be between 30–40 °C (Dosta et al., 2008), and (iii) SRT was high
enough to allow anammox growth.
Nitrogen balance was already slightly unfulfilled in period II when DO concentration
in the bulk liquid was low, but temperature was not optimal for anammox microorganisms (20
°C). So it could be hypothesised that anammox were not the responsible of such unfulfillment
in nitrogen balance. However, SRT was extremely high in period II and it was reported that
anammox bacteria need a minimum SRT of 85 days at 15 °C (Morales et al., 2015), which is
lower than the SRT in the airlift reactor and, furthermore, temperature was higher than 15 °C,
which is expected to decrease such minimum SRT value. Therefore, the appearance of
anammox could be expected already during period II.
![Page 124: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/124.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
101
Fig. 7.5. Batch test performed on day 603 (period IV) for evaluating the anammox activity in
the lab-scale airlift reactor. DO concentration < 0.3 mg O2 L-1 during the anoxic conditions;
pH = 8 ± 0.3.
Anammox bacteria use ammonium as electron donor and nitrite as electron acceptor to
remove nitrogen as N2 gas (i.e. anammox process consists of an autotrophic denitrification).
However, part of the nitrite is oxidized to nitrate in the anammox reaction. Thus, anammox
could contribute to the nitrate production in the bulk liquid of the granular airlift reactor.
Nevertheless, the nitrate theoretically produced if the disbalance obtained in period II was due
to the production of N2 by anammox bacteria was calculated (see details in Section 7.2.5) and
it resulted much lower than the nitrate actually produced in the reactor. Therefore, anammox
bacteria could be present in the granular sludge but still its activity was dismissible compared
to NOB activity. When temperature was lowered to 10 ºC at the end of period III (day 673)
the nitrogen balance was recovered with an average value of 93 ± 4%. The wash out of
anammox bacteria was expected due to the combination of the following facts: low
temperature (10 ºC), high DO concentration (2.5 ± 0.6 mg O2 L-1) and low SRT (12 ± 12
days).
The growth of anammox in the lab-scale airlift reactor would be beneficial if the aim
of the study was operating a one-stage system where both AOB and anammox bacteria were
responsible of the autotrophic nitrogen removal in a single reactor. However, the present
Time (min)
0 100 200 300 400
N-s
peci
es (m
g N
L-1
)
0
10
20
30
40AmmoniumNitriteNitrate
Oxicconditions Anoxic conditions
![Page 125: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/125.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
102
study aimed for a two-stage system and more precisely for the development of a stable partial
nitritation process in one single reactor, so the presence of anammox bacteria was not
desirable. In any case, the temperature decrease had a negatively effect on the anammox
population and anammox activity faded in the system. Once anammox activity did not take
place in the reactor the nitritation activity increased. It was surmised that anammox bacteria
could not compete with NOB for the nitrite anymore, and thus nitratation activity caused by
NOB increased at the end of the operation.
7.3.3. Microbial characterization
The lab-scale airlift reactor was operated performing stable partial nitritation at 10 °C
for 400 days and afterwards, the nitratation activity developed and fluctuated for 300 days
more at different temperatures of operation (Fig. 7.1). The analysis of operational data
suggested that the increase of nitratation activity could be due to the development of NOB in
the granular sludge and also suggested that anammox bacteria developed in the granules.
Therefore, an exhaustive microbial characterization of the granular biomass of the lab-scale
airlift reactor was performed to confirm the hypothesis presented before about the appearance
of different microorganisms (NOB and anammox bacteria). The microbial characterization
was performed by using FISH-CLSM technique.
Samples of granular biomass from days 98, 233, 421, 498, 596, and 682 were analysed
to evaluate the AOB enrichment, NOB repression and presence of anammox bacteria during
the different periods of operation. Fig. 7.6 shows the results of FISH characterization together
with the operation of the granular airlift reactor, more specifically together with the nitrite and
nitrate concentrations in the bulk liquid.
A high enrichment in AOB was detected during the entire operation of the granular
airlift reactor. In fact, even in period II, when the nitratation activity increased in the reactor,
the abundance of AOB in the granular sludge was higher than 90% of the total population.
However, the AOB relative abundance decreased until 71 ± 3% of the total population at the
end of the operation (day 682), when the partial nitritation was totally destabilized, but still
then, AOB were the predominant microorganisms in the granular sludge of the granular lab-
scale airlift reactor.
![Page 126: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/126.jpg)
Fig. 7.6. FISH-CLSM results obtained through the long-term operation of the lab-scale airlift reactor treating a low strength synthetic influent.
Nitrite and nitrate concentrations together with temperature were plotted to facilitate the understanding of the developed microorganisms.
![Page 127: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/127.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
104
Regarding anammox bacteria, FISH analysis detected the appearance of anammox
microorganisms in the granular sludge at the end of period II (day 498) with a relative
abundance of 5 ± 2% of the total population. This fact confirmed the hypothesis suggested in
Section 7.3.2.2 where the presence of anammox bacteria in the granules was surmised
according to the slight nitrogen disbalance observed. Furthermore, a high presence of
anammox bacteria was detected in period III (day 596) with a relative abundance of 17 ± 2%,
which agreed with the results of the anammox activity batch test performed on day 603 in the
airlift reactor and with the nitrogen disbalance at the beginning of such period. Hence,
anammox bacteria appeared in the granular sludge in period II when temperature increased to
20 ºC and continued growing in granules during period III. The presence of anammox bacteria
was not analysed by FISH at the end of the operation (on day 682) since temperature was low
(10 ºC) and nitrogen balance was fulfilled, however the relative high percentage of
microorganisms without identification by FISH on the sample analysed (21%) could suggest
that anammox bacteria still remained in the granules, which was expected since the wash out
of microorganisms from the inner part of the granule should be gradual due to the slow
detachment. In any case, FISH results regarding anammox bacteria agreed the operational
results described in Section 7.3.2.2, by confirming the presence of anammox bacteria in the
granular sludge of the airlift reactor in periods II and III.
FISH technique was also used to evaluate the presence of NOB species during the
long-term operation of the granular sludge airlift reactor. NOB species were expected to be
present in the granular sludge when nitratation activity was high, however FISH results were
controversial. On the one hand, FISH-CLSM analysis confirmed the efficient NOB repression
achieved in period I, since only 1 ± 1% of the total population was identified as NOB
(specifically Nitrobacter spp.) on sample of day 233. Nitrobacter spp. are r-strategist
microorganisms and, consequently, are favoured to grow at high TNN concentrations, such as
those in the airlift reactor of this study. Hence, FISH confirmed the NOB repression observed
during period I, and the presence of a NOB species expected to grow at the conditions of
period I. However, at the beginning of period II (day 421) any NOB (nor anammox) species
were detected in granules, despite the increase of nitratation activity, so FISH results could
not explain the high production of nitrate in the bulk liquid of the reactor. Furthermore, FISH
analysis did not show the presence of NOB either at the end of period II (day 498), when the
highest nitratation activity was observed in the airlift reactor. Hence, FISH analysis could not
confirm that the high nitrate production observed in the bulk liquid of the reactor was due to
![Page 128: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/128.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
105
the growth of NOB in the granular sludge of the lab-scale airlift reactor. Surprisingly, FISH
analysis did identified the NOB species Nitrospira spp. for the first time during period III of
operation, with relative abundances of 6 ± 4% and 8 ± 2% on days 596 and 682, respectively.
Nitrospira spp. are k-strategist microorganisms which are favoured to grow at low TNN
concentrations. During period I of operation, a residual TNN concentration was maintained in
the bulk liquid (35 ± 4 mg N-NO2- L-1) and thus, Nitrospira spp. were not expected in the
reactor. However, from period II onwards, TNN concentration decreased to 17 ± 8 mg N L-1,
which could favoured the appearance of the Nitrospira population.
Hence, according to FISH analysis, NOB population was barely detected during the
period I of operation (specifically Nitrobacter spp.) but was clearly detected during the period
III (specifically Nitrospira spp.); nevertheless, NOB population was never detected between
those two periods, which corresponded to the moment with the highest nitratation activity of
the operation. The reason why FISH could not identify any NOB species during period II and
the reason why NOB population changed from Nitrobacter spp. to Nitrospira spp. remained
unclear.
7.3.4. Development of an enriched NOB biofilm in the riser of the airlift reactor
The long-term operation of the lab-scale granular sludge airlift reactor treating a low-
strength synthetic influent comprised a period of 400 days achieving a stable partial nitritation
at 10 ºC, and afterwards the process destabilized and different periods of stable and unstable
operation were defined for 300 days more. A high SRT and anammox growth were
considered for trying to explain the destabilization of partial nitritation despite of using a low
DO/TAN ratio strategy (reported to achieve a successful NOB repression); however, even
when SRT was lowered, anammox activity decreased and an adequate DO/TAN
concentrations ratio was applied in the reactor, Nitrospira spp. appeared and triggered to a
high nitrate production and stable partial nitritation was never recovered in the system. Thus,
on day 700 of operation the reactor was shut down.
When the reactor was emptied, a huge biofilm was observed all along the internal part
of the riser of the airlift reactor (Fig. 7.7). A sample of this biofilm was analysed by FISH-
CLSM to evaluate the presence of NOB on it, since such presence could explain the high
content of nitrate in the period II of operation when NOB were not detected in granules. On
the one hand, a 40 ± 4% of the total population was identified as AOB and, furthermore, the
presence of NOB was detected with a 20 ± 2% of the total population, and more specifically,
![Page 129: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/129.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
106
it belonged to Nitrospira spp. On the other hand, Nitrobacter spp. were not detected in the
riser biofilm and anammox bacteria were not analysed.
Therefore, the low DO/TAN concentrations ratio applied in the bulk liquid of the
granular airlift reactor guaranteed a stable long-term operation for 400 days, however the
development of a biofilm of Nitrospira spp. in the riser of the reactor triggered the nitrate
production and destabilization of partial nitritation. The reason why the biofilm was formed
was not clear, since it could be due to different factors which could contribute to enhance
such formation: a high EPS formation at 10 ºC (see 5.3.3 of Chapter 5), a tendency of the
biomass to form biofilms, the long SRT applied, etc; but the effect of these factors on the
biofilm formation was not demonstrated in this study.
Fig. 7.7. A: Image of the clean riser of the airlift reactor; B: image of the riser of the airlift
reactor when the biofilm developed; and C: overlapped FISH image of a sample from the
biofilm developed in the riser of the airlift reactor, where AOB can be observed in pink and
Nitrospira spp. in turquoise (mixture of dark blue and light green) (C).
In any case, NOB were not present in the granules until the end of the operation,
despite of the formation of a biofilm full of NOB in the riser. This could be explained due to
that the high TNN concentration in the bulk liquid of the reactor enhanced the selection of
Nitrobacter spp. instead of Nitrospira spp. in the granules and thus, the DO/TAN strategy
applied guaranteed strong oxygen limiting conditions in the granules, which allowed the NOB
repression. The appearance of NOB in the granules from day 596 onwards was probably due
to the detachment of NOB from the biofilm and, actually, the slight increase of NOB on day
682 was probably due to a more detachment from the biofilm rather than NOB growth in
![Page 130: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/130.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
107
granules, since DO/TAN strategy was demonstrated to achieve an efficient NOB repression in
this system (period I) and in other similar systems (Bartrolí et al., 2010; Isanta, 2015a; Jemaat
et al., 2013). Besides, the NOB present in samples from the end of the operation belonged to
Nitrospira spp. as the NOB present in the riser biofilm, which supported the detachment
hypothesis.
In any case, the formation of biofilm in the riser was unexpected and unstudied in the
present work, and further research should be done to establish the causes of its appearance
and the development of Nitrospira species on it. The reasons why Nitrospira spp. (k-
strategists) appeared on the riser biofilm while Nitrobacter spp. did not appear on it remained
unclear and further research should be needed. It could be hypothesised that Nitrospira spp.
developed in the biofilm because it was the only available niche to compete with AOB since
SRT was infinite and Nitrospira spp. were reported to have more affinity for oxygen than
AOB (Regmi et al., 2014).
7.4. PRACTICAL IMPLICATIONS
The application of the DO/TAN strategy guaranteed the formation of aerobic granules
enriched in AOB where NOB (specifically Nitrobacter spp.) were almost washed out from the
system, guaranteeing a stable partial nitritation process at mainstream conditions. The
operation was maintained stable for 400 days operating at 10 ºC, which demonstrated the
strong effectiveness of the proposed system, which would be adequate for a further
implementation at pilot-scale.
However, the operation was destabilized for reasons unknown but highly discussed
above, which maybe could be avoided if more attention was previously paid to some
operational issues:
SRT should not be overlooked in any biological system although there was a different
strategy applied to control competitions between microorganisms.
The reactor walls should be periodically cleaned to avoid biofilm formation. The high
presence of NOB were only detected in the biofilm of the riser, but never detected in
granules, demonstrating the strong effectiveness of the DO/TAN strategy. Thus, the
biofilm formation should be totally avoided. With a real-scale perspective, a periodical
![Page 131: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/131.jpg)
Chapter 7. Development of nitratation activity after the long-term stable partial nitritation of a low-strength wastewater in a granular airlift reactor
108
cleaning of the reactor walls could be not feasible, so the use of anti-adherent
materials for building the reactor could be an option.
7.5. CONCLUSIONS
The lab-scale granular sludge airlift reactor of the present study achieved a stable
operation in the long-term at mainstream conditions.
Furthermore, the DO/TAN strategy was demonstrated as an efficient strategy to
guarantee NOB repression, since NOB was strongly repressed in the granules even operating
at an extremely high SRT.
The system destabilized most probably due to the appearance of a biofilm in the riser,
which had a high content of Nitrospira spp.
![Page 132: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/132.jpg)
Chapter 8
LOW-STRENGTH WASTEWATER TREATMENT IN AN
ANAMMOX UASB REACTOR: EFFECT OF THE LIQUID
UPFLOW VELOCITY
![Page 133: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/133.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
110
A modified version of this chapter is being prepared for publishing as:
Reino C. and Carrera J. 2016. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity. In preparation.
![Page 134: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/134.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
111
Abstract
Two-stage systems have been proposed to overcome the drawbacks associated to the
implementation of the autotrophic biological nitrogen removal process in the mainstream of
urban wastewater treatment plants. In this study, an upflow anammox sludge blanket
(UAnSB) reactor was successfully operated for 325 days treating a low-strength synthetic
influent mimicking mainstream conditions. A nitrogen loading rate of up to 1.8 ± 0.2 g N L-1
d-1 was achieved and the nitrogen removal rate obtained (1.7 ± 0.1 g N L-1 d-1) resulted
considerably higher than most of the previously reported values for systems treating low-
strength wastewater. FISH analysis showed a high enrichment in the anammox specie
Candidatus Brocadia anammoxidans during the whole operation. The evolution of the
granule diameter was followed throughout the operation of the UAnSB reactor and a direct
correlation of the average granule diameter with the liquid upflow velocity (Vup) was
established, being the higher the Vup, the bigger the granules. A stable granule diameter of
790 ± 40 μm was achieved by maintaining a Vup of 1.0 ± 0.1 m h-1. The low VupS applied
avoid the use of effluent recirculation which would present a huge inconvenient to implement
UAnSB reactors at real scale, however these low VupS led to external mass transfer limitations
in the reactor. In spite of the mass transfer limitations, not only a high specific anammox
activity (0.26 ± 0.02 g N g-1 VS d-1) was achieved in the UASB reactor but also a high
nitrogen removal (80 ± 3%).
![Page 135: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/135.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
112
![Page 136: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/136.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
113
8.1. INTRODUCTION
The implementation of the autotrophic biological nitrogen removal (BNR) in the
mainstream of urban wastewater treatment plants (WWTPs) has been proposed as the main
alternative for achieving a neutral energy-consumer or even an energy-producer urban WWTP
(Kartal et al., 2010; Siegrist et al., 2008). The neutral energy-consumer urban WWTP is based
on the use of most of the entering organic matter to produce biogas (with the subsequent
energy recovery) plus the reduction of aeration costs due to the lower oxygen requirements of
the autotrophic BNR compared to the conventional BNR trough nitrification and
heterotrophic denitrification. Hence, it consists of a first step of organic matter removal (A-
stage) and a second step of autotrophic BNR (B-stage) where the A-stage effluent is treated
through the nitritation and anaerobic ammonium oxidation (anammox) processes.
The B-stage can be implemented either in one single reactor (one-stage systems) or in
two reactors (two-stage systems). Recently, many studies were focused on the implementation
of autotrophic BNR treating low-strength wastewater by using one-stage systems (De
Clippeleir et al., 2013; Gilbert et al., 2014; Hu et al., 2013; Lackner et al., 2015; Laureni et al.,
2016), however these systems present some significant disadvantages: (i) low nitrogen
removal rates achieved; (ii) destabilization of the partial nitritation in the long term; and (iii)
competition for nitrite of nitrite oxidizing bacteria (NOB) and anammox bacteria with the
subsequent destabilization of anammox process. Thus, the two-stage strategy has appeared as
an alternative to overcome these problems, since allows a more stable performance and
control of the partial nitritation and anammox processes (Isanta et al., 2015a; Ma et al., 2011a;
Pérez et al., 2015; Reino et al., 2016).
The application of the anammox process at mainstream conditions (low-strength and
low temperature) appears as a prerequisite for the implementation of a two-stage system for
autotrophic BNR in urban WWTPs. Thus, many efforts have been made to achieve a
successful start-up and operation of anammox reactors treating mainstream wastewater
(Awata et al., 2015; Hendrickx et al., 2014; Laureni et al., 2015; Lotti et al., 2014b; Ma et al.,
2013). The main disadvantage of anammox process is the very long doubling time (10–12
days) of the anammox bacteria (Dosta et al., 2008; Strous et al., 1999). This slow growth is
even more troublesome at mainstream conditions because of (i) the low biomass growth rate
due to the operation temperature under the optimum range and (ii) the low net biomass
production due to the low nitrogen content of the stream (Morales et al., 2015). Therefore, a
![Page 137: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/137.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
114
high solids retention time (SRT) is needed to increase the biomass concentration in the system
and guarantee the growth of anammox at mainstream conditions.
One efficient alternative to achieve a high SRT is the use of granular sludge
(Fernández et al., 2008; Strous et al., 1998; van der Star et al., 2007). Different reactor
configurations have been proposed for achieving granular sludge under anaerobic conditions:
sequencing batch reactors (SBRs), filters, expanded bed and fluidized bed reactors, among
others (Liu et al., 2003). However, the use of Upflow Anaerobic Sludge Bed (UASB) reactors
appear as the most attractive alternative for the implementation of anammox process
(Hulshoff Pol et al., 2004; Imajo et al., 2004; Tang et al., 2011). The main advantage over
other reactors is that UASB reactors present a high biomass retention capacity which allows
achieving extremely high loading rates, and furthermore, the requirements of area and reactor
size are low. However, UASB reactors usually operate at upflow velocities as low as 0.5–1.5
m h-1 (Latif et al., 2011; van Haandel and van der Lubbe, 2012), which can trigger to external
mass transfer limitations due to the lack of efficient mixing in the sludge bed.
Biomass granulation is a complex process that can be affected by different factors;
either physical and chemical factors related to the process conditions applied, or even
biological factors such as the cell-to-cell communication (quorum sensing) (Liu et al., 2003).
The selection pressure imposed on the sludge is one of the factors affecting granulation. Thus,
the selection pressure theory hypothesizes that granulation process strongly depends on the
continuous selection of sludge particles that occurs in the reactors, in such a way that high
selection pressure would wash-out light and dispersed sludge while heavier sludge could be
retained in the system (Hulshoff Pol et al., 2004; Liu et al., 2003). The selection pressure may
result from any environmental condition, such as temperature, pH, hydraulic retention time,
upflow velocity (Vup), reactor configuration, etc. In the case of UASB reactors, selection
pressure generally depends on the liquid Vup and gas production, which affect to the shear
force imposed to biomass. Thus, high liquid VupS lead to high hydrodynamic shear forces
which enhance the granulation process (Arne Alphenaar et al., 1993; Liu and Tay, 2002).
Hence, to overcome the limitations associated to UASB reactors (specifically external
mass transfer problems), a variant of UASB reactors, Expanded Granular Sludge Bed (EGSB)
reactors, appeared as an alternative for implementing the anammox process. In this way, Lotti
et al. (2014b) reported high nitrogen loading rates (NLRs) in an anammox EGSB reactor
treating urban wastewater, even at 10 ºC. In EGSB reactors, liquid Vups are higher than 4 m
h-1 to cause the granular sludge bed to expand (Seghezzo et al., 1998). For the implementation
![Page 138: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/138.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
115
of the anammox process in EGSB such high Vups are achieved by recycling part of the
effluent, i.e. a liquid recirculation is used. Nevertheless, the need of a liquid recirculation is
problematic for the real-scale implementation of the anammox process in the mainstream of
urban WWTPs since too high recirculation flows would be needed and, consequently,
operational costs would be unacceptable. By now, few studies have focused on the effect of
Vup on the operation of anammox UASB (UAnSB) reactors and besides, to the best of the
author’s knowledge, all have focused on operations with high-strength wastewaters (Jin et al.,
2012; Xing et al., 2014).
Therefore, this study aimed to (i) implement the anammox process in an UASB reactor
treating a low-strength synthetic influent achieving high nitrogen removal rates and high
effluent quality, and (ii) study in depth the effect of the liquid Vup on the UAnSB reactor
operation, specifically by following the granulation through the operation of the reactor.
8.2. MATERIAL AND METHODS
8.2.1. Reactor, experimental set-up and operation
The anammox process was carried out in a lab-scale UASB reactor with a working
volume of 2 L including the gas-liquid-solid separator. The detailed diagram of the reactor
and set-up details are described in Section 4.1.2, Chapter 4. The pH was not controlled but
measured offline and its value was 7.9 ± 0.2 during the whole operation, as the pH of the
influent was set at 7.5 ± 0.2. Influent was devoid of oxygen and the dissolved oxygen
concentration in the bulk liquid of the reactor was always 0 mg L-1. The temperature was
measured and controlled by means of an electric heater connected to a temperature controller.
The cooling system detailed in Section 4.1.2, Chapter 4 was not used in the present study.
The reactor operation was divided in four different periods, each one corresponding to
a different NLR applied. The period I (days 0–50) corresponded to the start-up period when
the NLR was gradually increased until a stable value was achieved. During period I, the
temperature was controlled at 32 ºC. Period II (days 50–200) corresponded to the stable
operation at a fixed NLR. Period III (days 200–250) was a period of transition when NLR was
gradually increased again, until achieving a stable value in Period IV (days 250–325). During
periods II to IV, the temperature was controlled at 26 ºC. Since substrate concentrations were
not changed during the operation, NLR was changed by varying the inflow. Thus, changes in
![Page 139: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/139.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
116
NLR lead to changes in liquid Vup in the UAnSB reactor since the liquid Vup was only linked
to inflow (no recirculation was used), so the periods of operation could also be related to the
different Vups.
8.2.2. Inoculum and synthetic wastewater
The UAnSB reactor was inoculated with 500 ml (13 g L-1) of settled anammox
granular biomass from an anammox SBR working at 35 ºC under stable conditions for more
than one year (Isanta et al., 2015b). The operational characteristics of the anammox SBR are
shown in Table 8.1. The inoculum was enriched in anammox bacteria, more specifically in
Candidatus Brocadia anammoxidans, with an abundance of 86 ± 3% as analysed by
fluorescence in situ hybridization (FISH). Candidatus Kuenenia stuttgartiensis was also
analysed by FISH but not detected in the sample. On day 27 more biomass from the inoculum
was added to the reactor to increase a 25% the sludge bed volume.
Table 8.1. Operational characteristics of the SBR which provided the inoculum of the UASB
anammox reactor. (NLR = Nitrogen Loading Rate; NRR = Nitrogen Removal Rate)
Parameter Average value Units
NLR 0.45 ± 0.09 g N L-1 d-1
NRR 0.36 ± 0.09 g N L-1 d-1
[N-NH4+]influent 180 ± 30 mg N L-1
[N-NO2-]influent 190 ± 30 mg N L-1
Average granule diameter 920 ± 90 μm
The UAnSB reactor was fed with a synthetic influent mimicking the effluent of a
previous partial nitritation reactor treating a municipal low-strength wastewater as the one
described in Chapter 5. During periods I, II and III the synthetic influent contained 35 mg N-
NH4+ L-1 in the form of (NH4)2SO4 and 35 mg N-NO2
- L-1 in the form of NaNO2, which meant
a nitrite to ammonium concentrations ratio of 1. However, from day 244 onwards the nitrite to
ammonium concentrations ratio in the influent was increased until 1.20 ± 0.06 to adjust the
substrate concentrations to the reported anammox stoichiometry (Strous et al., 1998),
![Page 140: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/140.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
117
resulting in average concentrations of 33 mg N-NH4+ L-1 and 38 mg N-NO2
- L-1. In addition,
1000 mg KHCO3 L-1, 50 mg NaH2PO4 L-1, 100 mg CaCl2·2H2O L-1, 200 mg MgSO4.2H2O L-
1, 6.3 mg FeSO4 L-1, 6.3 mg EDTA L-1 and 1.25 mL L-1 of a trace elements solution with 15 g
EDTA L-1, 0.43 g ZnSO4.7H2O L-1, 0.24 g CoCl2.6H2O L-1, 0.99 g MnCl2.4H2O L-1, 0.25 g
CuSO4.5H2O L-1, 0.20 g NiCl2.6H2O L-1, 0.20 g NaSeO4.10H2O L-1, 0.014 g H3BO3 L-1 and
0.22 g NaMoO4.2H2O L-1 were supplied to the synthetic influent.
8.2.3. Calculations
The nitrogen removal rate (NRR) was calculated as the removal of substrates
(ammonium and nitrite) without considering the nitrate produced in the anammox reaction.
Conversely, nitrate produced was considered for the calculation of the nitrogen removal
efficiency (NRE), since this parameter is more accurate to talk about N-removal from a real
implementation point of view. Liquid Vup (in m h-1) was determined with the inflow rate (Q,
in m3 h-1) and the cross-sectional area of the reactor (A, in m2), as follows:
= (Eq. 8.1)
ccording to film theory model, mass transfer between the bulk liquid and the granule
(or external mass transfer) is driven by a concentration gradient across an external boundary
layer (LL, in m). The mass flow of a component in the LL is proportional to the difference
between the component concentration in the bulk liquid and the granule surface, with the
proportionality constant being the external mass transfer coefficient (kc, in m d-1) (Prehn et al.,
2012; Wanner et al., 2006). Then, the mass transfer coefficient is:
= (Eq. 8.2)
where DF is the diffusion coefficient for substrate in water (in m2 h-1).
For slow flow velocities or low turbulence, the value of LL is large (high external mass
transfer limitations) while for fast flow or high turbulence, LL is small (low external mass
transfer limitations). Both parameters (kc and LL) are usually calculated from experimental
correlations (Wanner et al., 2006). For example, for laminar hydraulic flows around spherical
particles, the following correlation can be used:
ℎ = 2 + 0.6 ∗ / ∗ / (Eq. 8.3)
![Page 141: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/141.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
118
where Sh is the non-dimensional Sherwood number, Re is the non-dimensional Reynolds
number and Sc is the non-dimensional Schmidt number.
Sherwood, Reynolds and Schmidt numbers are defined as:
ℎ = ∗ (Eq. 8.4)
= ∗ ∗ (Eq. 8.5)
=∗
(Eq. 8.6)
where µw is the water viscosity (in kg m-1 h-1), ρw is the water density (in kg m-3), dg is
the average granule diameter (in m) and Vup is the upflow liquid velocity (in m h-1).
8.2.4. Fluorescence in situ hybridization (FISH)
Relative abundances of anammox bacteria were analysed by FISH technique coupled
with confocal laser scanning microscopy (CLSM) as described in Section 4.3.1 of Chapter 4.
Specific probes for Candidatus Brocadia anammoxidans and Candidatus Kuenenia
stuttgartiensis were 5’-TxRed-labeled. Hybridization protocol and probes are fully described
in Section 4.3.1 of Chapter 4.
8.2.5. Specific analytical methods
Liquid samples from influent and effluent of the UAnSB reactor were withdrawn to
determine ammonium, nitrite and nitrate concentrations three days per week, according to
Section 4.2.1, Chapter 4. Average particle size and particle size distribution were periodically
measured by a laser particle size analysis system (Malvern Mastersizer Series 2600, Malvern
instruments Ltd., UK). Sampling for size analysis was always performed at 145 mm of height
of the UAnSB reactor, except in the case of the stratification studies when the sampling point
was specified in the corresponding section of the results. Maximum specific anammox
activity (SAA) was determined by measuring the overpressure generated by the anammox
sludge in closed bottles according to the methodology described by Dapena-Mora et al.
(2007). During this protocol for determine maximum SAA, bottles were maintained in a
shaker at 150 rpm to favour mixing and reduce external mass transfer limitations.
![Page 142: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/142.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
119
8.3. RESULTS AND DISCUSSION
8.3.1. Operation of the UAnSB reactor
The lab-scale UAnSB reactor was inoculated (day 0) with anammox biomass from a
SBR which was operating at 35 ºC with an average SAA of 0.25 ± 0.02 g N g-1 VS d-1 (Isanta
et al., 2015b). During the start-up period (days 0–50) NLR was gradually increased from 0.09
to 0.78 g N L-1 d-1 and NRE fluctuated between 73% and 84% until stable operation was
achieved from day 50 onwards with an average NRE of 76 ± 3% on period II. Table 8.2
reports the operational parameters corresponding to the different periods of operation of the
UAnSB reactor. During period II the reactor was operated for 150 days at an average NLR of
0.8 ± 0.2 g N L-1 d-1 and an average NRE of 76 ± 3%. Furthermore, in period IV the reactor
achieved a stable operation for more than 2 months with an average NLR of 1.8 ± 0.2 g N L-1
d-1 and a better NRE (80 ± 3%).
The nitrite to ammonium consumption ratio and the nitrate produced to ammonium
consumed ratio increased during operation until period IV, achieving average values of 1.20 ±
0.08 and 0.26 ± 0.03, respectively. These average values are close to the previously reported
for anammox cultures (Lotti et al., 2014c; Strous et al., 1998). At the end of period III (on day
244) the nitrite to ammonium concentrations ratio in the influent was increased from 1.0 to
1.2 and an improvement of the ammonium removal efficiency was observed in the UAnSB
reactor. In view of that, although nitrite was always observed in the effluent (3.8 ± 0.9 g N-
NO2- L-1), the reactor was limited by nitrite probably due to external mass transfer problems
in the sludge bed.
The achieved NRR value in the UAnSB reactor (1.7 ± 0.1 g N L-1 d-1 in period IV)
was considerably higher than most of the previously reported values for systems treating low-
strength wastewater. Table 8.3 shows the NRR achieved in both, one and two-stage systems.
On the one hand, NRR achieved in this study was much higher than any NRR reported in one-
stage systems. On the other hand, regarding two-stage systems, the NRR achieved in this
study was comparable to the one obtained by Lotti et al. (2014b) in an anammox EGSB
reactor (1.40–1.85 g N L-1 d-1 at 20 ºC) and only lower than the reported by Ma et al. (2013)
(5.7 g N L-1 d-1 at 30 ºC) which was achieved in a UAnSB reactor operating at a Vup as high
as 11 m h-1. Probably, the higher NRR achieved by Ma et al. (2013) was strongly correlated to
the high Vup applied in its reactor, which favoured mixing and thus, overcame external mass
transfer limitations in the sludge bed.
![Page 143: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/143.jpg)
Table 8.2. Periods of operation and operational parameters of the UASB anammox reactor. Since in period I and III nitrogen loading rates were
being increased and continuously changing, a range of NLR and NRR values was presented. (NLR = nitrogen loading rate; NRR = nitrogen
removal rate; NTot effluent = total nitrogen concentration in the effluent; ∆N-NO2-/∆N-NH4
+ = nitrite to ammonium consumption ratio;
∆N-NO3-/∆N-NH4
+ = nitrate produced to ammonium consumed ratio).
Period Days NLR
(g N L-1 d-1)
NRR
(g N L-1 d-1)
NTot effluent
(mg N L-1)
∆ -∆ -
∆ -∆ -
I 0-50 0.09–0.78 0.08–0.69 15 ± 4 1.01 ± 0.12 0.21 ± 0.08
II 50-200 0.8 ± 0.2 0.7 ± 0.1 17 ± 2 1.05 ± 0.07 0.25 ± 0.02
III 200-250 1.0–1.6 0.9–1.5 17 ± 2 1.14 ± 0.08 0.25 ± 0.02
IV 250-325 1.8 ± 0.2 1.7 ± 0.1 15 ± 2 1.20 ± 0.08 0.26 ± 0.03
![Page 144: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/144.jpg)
Table 8.3. Review of the NRR achieved in different reactors treating low-strength wastewater either in one or two-stage systems.
Type of System Type of Reactor Influent T
(ºC)
Vup
(m h-1)
NRR
(g N L-1 d-1) Reference
One-stage
systems
Rotating Biological Contactor Synthetic 29 - 0.47 De Clippeleir et al. (2013)
Rotating Biological Contactor Synthetic 25 - 0.44 De Clippeleir et al. (2011)
Gaslift Reactor Semi-synthetic 25 - 0.26 Hendrickx et al. (2012)
Moving Bed Biofilm Reactor Synthetic 20 - 0.04 Gilbert et al. (2014)
Airlift Reactor Synthetic 20 - 0.44 Lotti et al. (2014a)
Plug-Flow Granular Pilot-Scale Reactor Urban wastewater 19 - 0.20 Lotti et al. (2015a)
Two-stage
systems
UAnSB Reactor Urban wastewater 30 11 5.72 Ma et al. (2013)
UAnSB Reactor Urban wastewater 27–30 1.2 0.40 Ma et al. (2011)
Upflow Fixed Bed Biofilm Reactor Synthetic 27 - 0.81 Gao et al. (2014)
EGSB Reactor Urban wastewater 20 20 1.40–1.85 Lotti et al. (2014b)
UAnSB Reactor Synthetic 26 1 1.7 ± 0.1 This study
![Page 145: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/145.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
122
Biomass concentration of the sludge bed in the UAnSB reactor was stable throughout
the study, with an average value of 6.3 ± 0.4 g VS L-1. The sludge had a high inorganic
content since the VS/TS ratio was 0.48 ± 0.05. Biomass concentration in the effluent
accounted for less than 9 mg VS L-1 resulting in a SRT of 45 ± 15 days. Regarding to the
settling properties of the granules, a good settling ability was observed during the whole
operation, with an increase of the settling velocity from 19 ± 5 m h-1 in period II to 31 ± 9 m
h-1 in period IV. Settling velocities achieved were in the range of the corresponding to
granular biomass (from 20 to 150 m h-1; Cervantes, 2009).
Regarding the microbiological characterization of the sludge, FISH-CSLM was used
to determine the enrichment in anammox bacteria during the whole operation of the UAnSB
reactor. Thus, biomass samples on day 0 (inoculum), day 117 (period II) and day 314 (period
IV) were analysed. On the one hand, Candidatus Brocadia anammoxidans was found to be
the predominant microbial specie in the sludge bed, with percentages of the total population
of 86 ± 3% (day 0), 92 ± 2% (day 117) and 93 ± 2% (day 314). Hence, a high enrichment in
anammox bacteria was maintained in the granular sludge bed throughout the study. On the
other hand, Candidatus Kuenenia stuttgartiensis appeared at the end of the operation of the
UAnSB reactor (1 ± 1% on day 314) although it was not detected in the inoculum nor in the
sample of day 117.
8.3.2. Effect of the liquid upflow velocity on the operation of the UAnSB reactor
8.3.2.1. Granulation
The evolution of the granule diameter was followed throughout the study (Fig.
8.1C). The inoculum had an average diameter of 920 ± 90 μm, however during period I (start-
up) and the beginning of period II the granule size decreased gradually until reaching a
minimum value of 350 ± 10 μm after 100 days of operation. The slight increase of diameter
on day 46 was due to the addition of new biomass from the inoculum on day 27. After day
105, the granule diameter started to increase until reaching an average stable value of 790 ±
40 μm from day 220 onwards. Additionally, Fig. 8.1C shows the fraction of biomass
considered as granule, i.e. particle diameter bigger than 200 μm, which resulted higher than
70% during the whole operation of the UAnSB reactor, even when the granulation was
dropping. Moreover, Fig. 8.2 shows the granule size distribution at different reactor operation
days. The unimodal shape was maintained despite of the first decrease and later increase of
![Page 146: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/146.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
123
the mean diameter, so there was mainly only one type of granule and the homogeneity of the
sludge was maintained during the operation.
Fig. 8.1. Continuous operation of the UAnSB reactor treating low-strength synthetic
wastewater. (A) Nitrogen loading rate (NLR) and nitrogen removal rate (NRR); (B) Upflow
liquid velocity; (C) Granule size evolution.
0 50 100 150 200 250 300
Aver
age
gran
ule
diam
eter
m
0
200
400
600
800
1000
Frac
tion
of p
artic
les
(%)
0
20
40
60
80
100
Average granule diameter (m)Fraction of particles bigger than 0.2 mFraction of particles smaller than 0.2 m
NLR
and
NR
R(g
N L
-1 d
-1)
0.0
0.5
1.0
1.5
2.0
2.5NLRNRR
Upf
low
vel
ocity
(m h
-1)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
A
B
C
Period I Period II Period III Period IV
![Page 147: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/147.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
124
Fig. 8.2. Time course of the granule size distribution during the operation of the UAnSB
reactor treating low-strength synthetic wastewater.
It is known that high Vups favour granulation in UASB reactors (Arne Alphenaar et al.,
1993; Liu and Tay, 2002) and, in fact, a correlation of the mean granule diameter with the
liquid Vup was determined with data of periods II, III and IV when the granule size was
increasing (Fig. 8.3). It can be observed that there was a direct correlation (R2 = 0.86)
between both parameters. Moreover, two statements can be established from Fig. 8.3: (i) in
the range 0.4–0.6 m h-1, higher upflow velocities enhanced granulation leading to higher
granule diameters and (ii) there was a range of upflow velocities (from 0.8 m h-1 onwards)
from which the granule diameter reached a maximum stable value. Nevertheless, despite of
the liquid Vup was gradually increased during period I of operation, the average granule
diameter decreased significantly (Fig. 8.1B and 8.1C), and thus, data from period I were not
considered for the correlation of Fig. 7.3. The decreasing in granule size could be explained
because the range of Vups between 0–0.4 m h-1 was not high enough to maintain granulation,
but once Vup was higher in period II (0.4–0.6 m h-1) the drop in granule size was stopped and,
after some time operating under this higher range, the average granule diameter started to
increase. This meant that Vup was not a parameter with immediate effect on the granulation,
i.e. some time was needed to notice its effect. In addition to the low Vup applied in period I,
the change of the inoculum from an SBR to an UASB reactor could also be a reason to
explain the dropping in granule size. The settling time imposed to the biomass is the driving
force to favour granulation in SBRs, while in the case of UASB reactors the driving force is
Granule diameter (m)
1 10 100 1000 10000
Volu
me
of p
artic
les
(%)
0
2
4
6
8
10
Day 26 Day 105 Day 171 Day 263
![Page 148: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/148.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
125
the liquid Vup (Fig. 8.3). Hence, the change in the type of stress induced to the granules could
contribute to the destabilization and decrease in granule diameter during start-up and the
beginning of period II.
Fig. 8.3. Correlation of the diameter of the granules (dg) with the upflow liquid velocity (Vup)
applied in the UAnSB reactor. Correlation was obtained with data from periods II, III and IV
of operation.
As previously mentioned, the effect of Vup on the granulation was evident but not
immediate noticeable. Thus, during period III the Vup was sharply increased and as a result,
the diameter of the granules increased until reaching a stable value in period IV (average
value of 790 ± 40 μm at 1.0 ± 0.1 m h-1) (Fig. 8.1). However, throughout these periods, a
stratification of the granular sludge was visually observed along the longitude of the reactor;
there were big granules at the bottom and smaller granules at the top. Therefore, sludge
samples were taken and analysed at different heights of the UAnSB reactor (at 50, 145, 240,
345 and 450 mm of height) in order to confirm that the observed stratification was a fact
indeed. Fig. 8.4 shows the average granule diameter at different heights of the UAnSB reactor
during different operation days from the beginning of period III to the end of period IV (Vup
of 0.6–0.9 m h-1 in period III and 0.9–1.2 m h-1 in period IV). On the one hand, a clear
difference between granule diameters along the heights of the reactor was observed from day
203 to 235, with consecutive increases of diameter in consecutive decreases of height. This
difference was more evident comparing the three lower heights (50, 145, 240 mm) versus the
Upflow velocity (m h-1)
0.2 0.4 0.6 0.8 1.0 1.2
Ave
rage
gra
nule
dia
met
er (
m)
300
400
500
600
700
800
900
dg=1608 (1 - e-0.70 Vup)
R2=0.8651
![Page 149: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/149.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
126
two highest heights (345 and 450 mm). On the contrary, samples of days 263 and 292 showed
similar average diameters along the reactor heights, demonstrating the homogenization of
diameters through the sludge bed of the UAnSB reactor. Hence, in period IV not only the
average granule diameter was stabilized (Fig. 8.1C) but also the stratification of the sludge
bed was eradicated. Therefore, the increase in granule diameters caused by the operation of
the UAnSB at high VupS was progressive and stratified along the reactor which indicated that
the granule stabilization was a long process where almost 100 days were needed to achieve a
sludge bed stable in size and not stratified (Fig. 8.4).
The improvement of the granulation process at high liquid Vups was reported before.
Alphenaar et al. (1993) compared granulation in two UASB reactors performing anaerobic
treatment of sulphate-containing wastewater and observed considerably higher granule
diameters in the reactor with higher Vups (0.5 mm with 0.05 m h-1 and 1.2 mm with 0.65 m h-
1). Regarding anammox reactors, Ma et al. (2013) operated an UAnSB reactor treating low-
strength urban wastewater and observed the improvement of granulation when the Vup
increased from 1.26 to 11 m h-1 at 30 ºC. Even higher Vups (20 m h-1) were used by Lotti et al.
(2014b) in a lab-scale EGSB reactor treating also low-strength urban wastewater. However,
high recirculation of the effluent was needed to achieve these elevated Vups. Such a high
recirculation ratios (a recirculation ratio of 39 was used by Lotti et al. (2014b)) would present
a huge inconvenient to implement UAnSB reactors at real scale, since too high pumping costs
would be associated. In this study, substantially lower Vups (0.8 m h-1) were needed to
maintain granulation and stable operation of an UAnSB reactor treating a low-strength
synthetic wastewater. This would imply that no recirculation is needed and thus, a more
realistic implementation of the process in an urban WWTP would be possible.
![Page 150: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/150.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
127
Fig. 8.4. Stratification of the granular sludge bed in the UASB anammox reactor treating low-
strength synthetic wastewater. Missing values on day 203 and 248 were due to the lack of
sampling at the corresponding heights.
8.3.2.2. External mass transfer limitations
In UASB reactors, liquid Vup not only affects to granulation process but also to
the external mass transfer in the system. Low Vups can lead to insufficient mixing which
produce external mass transfer limitations and, hence, substrate accumulation in the effluent.
But also too high Vups can lead to the formation of preferential flows that contribute to
external mass transfer limitations as well. In fact, Lotti et al. (2014b) reported external mass
Reactor height (mm)50 145 240 345 450
Ave
rage
gra
nule
diam
eter
(m
)
0
200
400
600
800
1000DAY 203
Day 292
Reactor height (mm)50 145 240 345 450
0
200
400
600
800
1000DAY 221
Reactor height (mm)50 145 240 345 450
0
200
400
600
800
1000DAY 235
Reactor height (mm)50 145 240 345 450
0
200
400
600
800
1000DAY 248
Reactor height (mm)50 145 240 345 450
0
200
400
600
800
1000DAY 263
Reactor height (mm)50 145 240 345 450
0
200
400
600
800
1000DAY 292
Ave
rage
gra
nule
diam
eter
(m
)
Aver
age
gran
ule
diam
eter
(m
)
Aver
age
gran
ule
diam
eter
(m
)
Aver
age
gran
ule
diam
eter
(m
)
Ave
rage
gra
nule
diam
eter
(m
)
![Page 151: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/151.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
128
transfer limitations in an EGSB reactor treating urban wastewater due to the formation of
preferential flows, regardless of using high liquid Vups (20 m h-1). Thus, high substrate
concentrations were accumulated in the EGSB reactor (14 ± 9 mg N-NH4+ L-1 and 13 ± 11 mg
N-NO2- L-1).
Table 8.4 shows the values of Reynolds (Re) and Sherwood (Sh) numbers,
boundary layer (LL) and transfer coefficient (kc) calculated for each operational period of the
UAnSB reactor of this study. Before to discuss the calculations made to quantify the external
mass transfer limitations, it is important to note that: (i) the nitrite concentration in the bulk
liquid was never lower than 2.5 mg N-NO2- L-1, showing that the performance of the UAnSB
was probably affected by mass transfer limitations and (ii) Re values indicate that the liquid
flow in the UAnSB was clearly laminar for any Vup used in this study, and consequently, Sh
number can be calculated with Eq. (8.3).
Regarding the calculations of the external mass transfer limitations, Table 8.4
shows that as Vup increased, Re and Sh numbers increased. This could result in an
improvement of the mass transfer from the bulk liquid to the granule as reflected in the
increase of the achieved NRR. However, this improvement in the external mass transfer was
not reflected in the values of the mass transfer coefficient (kc) and the boundary layer (LL). In
fact, the highest kc, and consequently, the lowest LL were achieved in period II with a Vup half
than the used in period IV. Both values (kc and LL) not only depend on Vup but also depend on
granule diameter (dg). From Eqs. (8.2–8.6), it can be deduced that as dg increases, kc decreases
and LL increases, that is, external mass transfer limitations increase. Consequently, when Vup
and dg jointly increase, as it happened in periods II–IV, there exist two opposite effects over
the external mass transfer. In this study, both opposite effects caused that LL values were quite
similar in periods II, III and IV. In any case, LL values were always in the range 160–200 µm,
indicating that the UAnSB was always affected by external mass limitations. In fact, substrate
concentrations were always present in the effluent, with average values of 3 ± 1 mg N-NH4+
L-1 and 3.5 ± 0.8 mg N-NO2- L-1. Besides, SAA tests showed an average value of 0.35 ± 0.02
g N g-1 VS d-1 in period IV, while specific NRR in the UAnSB was of 0.26 ± 0.02 g N g-1 VS
d-1 during the same period. SAA tests were performed in bottles under continuous agitation
which enhanced mixing and reduced external mass transfer limitations. Hence, the difference
between SAA and NRR also demonstrated that the UAnSB reactor was affected by external
mass transfer limitations.
![Page 152: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/152.jpg)
Table 8.4. Operational parameters of the UAnSB for each period and external mass transfer calculations. Granule diameter (dg), upflow velocity
(Vup), nitrogen removal rate (NRR) and nitrite concentration in the bulk liquid are the experimental average values for each period. Reynolds
(Re) and Sherwood number (Sh) were calculated with Eqs. (8.5) and (8.3), respectively. External mass transfer coefficient (kc) was calculated
with Eq. (8.4) while external boundary layer was calculated with Eq. (8.2).
Period dg
(mm)
Vup
(m d-1)
Re
Sh
kc
(m h-1)
NRR
(g N L-1 d-1)
LL
(µm)
[N-NO2-]bulk liquid
(mg N L-1)
I 605 ± 105 0.21 ± 0.14 0.04 3.0 0.030 0.3 ± 0.2 204 3.6 ± 1.0
II 545 ± 74 0.48 ± 0.07 0.08 3.4 0.037 0.7 ± 0.1 162 4.0 ± 0.6
III 740 ± 87 0.79 ± 0.09 0.19 4.1 0.033 1.1 ± 0.3 182 3.7 ± 0.8
IV 806 ± 58 1.05 ± 0.07 0.27 4.5 0.034 1.7 ± 0.2 180 3.5 ± 1.0
![Page 153: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/153.jpg)
Chapter 8. Low-strength wastewater treatment in an anammox UASB reactor: effect of the liquid upflow velocity
130
Nevertheless, despite of the fact that the UAnSB reactor of the present study
presented external mass transfer limitations, the resulting operation with a NRR of 1.7 ±
0.1 g N L-1 d-1, a NRE of 80 ± 3% and a successful anammox granulation demonstrated
that UASB reactors appear as a good alternative to implement the anammox process at
mainstream conditions.
8.4. CONCLUSIONS
Stable anammox reaction was maintained in an UASB reactor treating a low-
strength synthetic wastewater. Significantly high NLR, NRR and NRE were achieved
compared to other similar systems. The anammox culture was highly enriched in
Candidatus Brocadia anammoxidans during the whole operation of the reactor.
Liquid upflow velocity was demonstrated to be a key parameter to be aware of
for the implementation of the anammox process in UASB reactors, since it affected to
granulation and external mass transfer. On the one hand, liquid Vup presented a direct
but not immediate effect on the anammox granulation, being the higher the Vup the
bigger the granules. On the other hand, the low liquid VupS applied led to external mass
transfer limitations which in any case affected to the high nitrogen removal of the
UAnSB.
![Page 154: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/154.jpg)
Chapter 9
STABLE LONG-TERM OPERATION OF AN ANAMMOX
UASB REACTOR AT MAINSTREAM CONDITIONS
![Page 155: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/155.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
132
A modified version of this chapter is being prepared for publishing as:
Reino, C., Suárez-Ojeda, M.E., Pérez, J., Carrera, J., 2016. Stable long-term operation of an
anammox UASB rector at mainstream conditions. In preparation.
![Page 156: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/156.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
133
Abstract
Efforts of implementing the anammox process at mainstream conditions with high
nitrogen removal rates have gained much attention in the race for achieving an energy-
positive urban wastewater treatment plant. A successful stable long-term operation at
mainstream conditions in an Upflow Anammox Sludge Bed (UAnSB) reactor treating a low-
strength synthetic influent for 350 days and a real urban wastewater for 110 days was
presented in this study. An exhaustive study of the effect of temperature on anammox activity
was performed when the synthetic influent was treated at mainstream conditions, and an
adaptation of anammox bacteria after long-term operation at low temperatures was observed.
In fact, a nitrogen loading rate as high as 0.93 ± 0.05 g N L-1 d-1 with a 82 ± 4% of nitrogen
removal were obtained at 11 ºC. Furthermore, the effect of treating a real urban wastewater at
11 °C at long-term in the UAnSB reactor was also evaluated, and a stable operation was
achieved with an extremely high average nitrogen removal rate (0.59 ± 0.05 g N L-1).
Anammox enrichment was maintained during the whole operation with abundance higher
than 70% according to fluorescence in situ hybridization, being Candidatus Brocadia
anammoxidans the predominant microbial species. The presence of heterotrophs in the sludge
bed was demonstrated through pyrosequencing technique and heterotrophic batch tests, but
anammox activity was demonstrated to be higher than heterotrophic activity, even when the
synthetic influent was replaced by the real urban wastewater. The feasibility of operating an
enriched anammox reactor at high nitrogen removal rate in the long-term at mainstream
conditions was demonstrated in this study.
![Page 157: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/157.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
134
![Page 158: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/158.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
135
9.1. INTRODUCTION
The anammox-based processes have been proposed as the most promising alternative to
guarantee energy-producer urban wastewater treatment plants (WWTPs) (Kartal et al., 2010;
Siegrist et al., 2008). Over the past decade, the anammox-based processes have been
successfully implemented in the sidestream treatment of urban WWTPs (Lackner et al.,
2014), however they has never been implemented in the mainstream. The main challenge of
the mainstream application is to achieve high nitrogen removal rates that guarantee a good
effluent quality. Thus, achieving a stable anammox operation in the long-term under
mainstream conditions is of paramount importance.
One of the challenges of the mainstream implementation of anammox process is the need
of dealing with a much lower range of wastewater temperatures compared to that of the
sidestream process (>30 °C). In fact, gradient from 20 to 10 °C was proposed by Gilbert et al.
(2015) to simulate the temperature gradient observed in urban WWTPs in moderate climates.
Low temperatures have been reported to cause a considerable decrease of anammox activity
(Dosta et al., 2008; Hu et al., 2013; Vázquez-Padín et al., 2011) despite that anammox
bacteria were reported to grow in natural ecosystems at temperatures below 4 °C, such as the
ones occurring on marine sediments (Rysgaard et al., 2004). Another challenge of the
mainstream operation of anammox processes is the nitrogen concentrations of the influent,
orders of magnitude lower than that of sidestream, which lead to decreasing net biomass
production. This is inadvisable since anammox bacteria are microorganisms with an intrinsic
very long doubling time (Strous et al., 1999). Thus, high solids retention time is needed to
increase the biomass concentration in the system in order to guarantee the growth of
anammox at mainstream conditions.
Recently, many studies were focused on the implementation of anammox process at
mainstream conditions, either in one-stage systems such as CANON (Completely Autotrophic
Nitrogen removal Over Nitrite) and OLAND (Oxygen-Limited Autotrophic
Nitrification/Denitrification) technologies; or in two-stage systems with the separation of
partial nitritation and the anammox process in two different reactors. On the one hand, a first
approach to mainstream conditions was done using one-stage systems, commonly called
partial nitritation/anammox (PN/A) systems. Lotti et al. (2014a) reported a stable operation
treating a synthetic influent at 15 °C, but process destabilization occurred in the long-term
operation at 10 °C. Similar results were obtained by Gilbert et al. (2015) which compared
![Page 159: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/159.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
136
different reactor configurations for PN/A systems treating a synthetic wastewater, but
destabilization occurred at temperatures below 13 °C. In the case of PN/A systems treating
real urban wastewater, perspectives were not better and Laureni et al. (2016) recently reported
the suppression of anammox activity at 11 °C. On the other hand, few studies reported stable
operation of single anammox reactors treating real urban wastewater at low temperatures.
However, these studies reported either low nitrogen removal rates which would lead to very
large bioreactor volumes (Hendrickx et al., 2014; Laureni et al., 2015) or high nitrogen
removal rates but high effluent recirculation ratios which would present a huge inconvenient
to implement the process at real scale (Lotti et al., 2014b; Ma et al., 2013).
The present study aimed at demonstrating the feasibility of achieving high nitrogen
removal rates through the anammox process operating at mainstream conditions in an Upflow
Anammox Sludge Blanket (UAnSB) reactor. Hence, an exhaustive study of the effect of low
temperatures (13 and 11 °C) on the long-term anammox operation at mainstream conditions
and, furthermore, the effect of treating a real urban wastewater on the anammox activity were
performed.
9.2. MATERIALS AND METHODS
9.2.1. Reactor set-up and operation
A lab-scale UASB reactor of 2 L of working volume including the gas-liquid-solid
separator was used. The experimental set-up details and a diagram of the reactor were
described in Section 4.1.2. of Chapter 4. The pH was not controlled, but measured off-line
and its value was of 8.1 ± 0.3 during the whole operation. Dissolved oxygen (DO)
concentration measured in the bulk liquid was always 0.0 mg L-1. The temperature was
measured and controlled by means of a cooling system and an electric heater (HBSI 0.8m,
HORST, Germany) connected to a temperature controller (BS-2400, Desin Instruments,
Spain). Three different temperatures of operation were tested: 22, 13 and 11 °C.
The operation of the UAnSB reactor was divided in two main parts regarding the type
of influent treated. Between days 0–350 a synthetic influent was treated at 22, 13 and 11 °C,
and between days 351–460 a real urban wastewater was treated at 11 °C.
![Page 160: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/160.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
137
9.2.2. Inoculum and wastewater characteristics
The UAnSB reactor was previously operated at high temperature (30–26 °C) treating a
synthetic influent for 325 days (details of the operation can be found in Chapter 8). Hence, at
the start of the current operation, the sludge bed was highly enriched in anammox bacteria,
with an abundance of 93 ± 2% of Candidatus Brocadia anammoxidans and 1 ± 1% of
Candidatus Kuenenia stuttgartiensis as identified by fluorescence in situ hybridization
(FISH).
From day 0 to 350 the UAnSB reactor treated a synthetic influent mimicking the
effluent of a previous partial nitritation reactor treating a municipal wastewater as the one
described in Chapter 5. The low-strength synthetic influent contained: 33 mg N-NH4+ L-1, 38
mg N-NO2- L-1, 1000 mg KHCO3 L-1, 50 mg NaH2PO4 L-1, 100 mg CaCl2·2H2O L-1, 200 mg
MgSO4.2H2O L-1, 6.3 mg FeSO4 L-1, 6.3 mg EDTA L-1 and 1.25 mL L-1 of a trace elements
solution (van de Graaf et al., 1996).
From day 351 to 460 the UAnSB reactor treated a real urban wastewater influent. A
real effluent from a partial nitritation reactor treating urban wastewater was not available at
the time the experiments were performed and, thus, a nitrite-amended secondary clarifier
effluent from an urban WWTP without nitrogen removal treatment located in an industrial
area of Catalonia (north-east of Spain) was used as influent. Nitrite was added as NaNO2 to
maintain a ratio between the nitrite and ammonium concentration of 1.3 ± 0.2. The tank with
the influent was periodically flushed with dinitrogen gas (N2) to guarantee a DO
concentration lower than 0.3 mg L-1. Table 9.1 shows the main characteristics of the real
urban wastewater after the N2 flushing and the nitrite addition.
9.2.3. Maximum specific heterotrophic activity
Heterotrophic activity of the biomass was evaluated with batch tests according to a
methodology adapted from Dapena-Mora et al. (2007) by measuring the overpressure
generated by the anammox enriched sludge in closed bottles. The overpressure generated in
the bottles was measured during the first 8 hours of the experiment to determine the
maximum activity of the biomass; however, the total duration of the experiments was about
24 hours in order to measure the final concentration of substrates and to confirm its removal.
Temperature was set at 30 °C and agitation was maintained at 150 rpm. Tests were performed
in triplicates. Two sets of tests were performed: (i) with biomass treating a synthetic influent
at 13 °C (day 274) and (ii) with biomass treating a real urban wastewater at 11 °C (day 420).
![Page 161: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/161.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
138
Table 9.2 shows the substrates used in each batch test and the corresponding
concentration. The ratio between carbon and nitrogen concentrations (C/N) was chosen to
ensure that organic carbon was present in excess (theoretical C/N was reported to be about
0.64 mg C mg-1 N for denitrification via nitrite (Henze et al., 2008) and 0.88 mg C mg-1 N for
denitrification via nitrate (Liu et al., 2007)).
Table 9.1. Characterization of the nitrite-amended secondary clarifier effluent used as the real
influent of the UAnSB reactor. COD is the chemical oxygen demand, and CODTot and CODSol
are the average concentrations of the total and soluble COD, respectively. DO is the dissolved
oxygen concentration.
Parameter Value Units
[N-NH4+] 30 ± 7 mg N L-1
[N-NO2-] 40 ± 7 mg N L-1
[N-NO3-] 1 ± 1 mg N L-1
CODTot 90 ± 20 mg O2 L-1
CODSol/CODTot 0.9 – 1 -
Total solids 10 ± 3 mg TS L-1
pH 8.4 ± 0.3 -
Conductivity 1.9 ± 0.3 mS cm-1
DO 0.2 ± 0.1 mg L-1
9.2.4. Inorganic elements analysis
A semi-quantitative analysis of the inorganic elements present in the sludge bed was
performed on days 0 and 423. Samples were pre-treated as follows: 0.1 grams of lyophilised
biomass were digested in a microwave digester (Mars, CEM) with concentrated HNO3 and
HCl. The analysis and quantification was done by inductively coupled plasma mass
spectrometry (ICP-MS, 7500ce, Agilent Technologies). The totality of this analysis was
outsourced to the Servei d’Analisis of the Universitat Autònoma de Barcelona.
![Page 162: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/162.jpg)
Table 9.2. Substrates used for the heterotrophic denitrification essays performed with biomass from the UAnSB reactor when a synthetic influent
and a real urban wastewater were treated. Ratio C/N is the ratio between the concentrations of total carbon and nitrogen.
Biomass Test [N-NO2
-]
(mg N L-1)
[N-NO3-]
(mg N L-1)
[C-Acetate]
(mg C L-1)
Ratio C/N
(mg C mg-1 N)
Biomass treating
synthetic wastewater
Only nitrite 25 ± 5 - - -
Nitrite + acetate 21 ± 8 - 35 ± 6 2 ± 1
Only nitrate - 16.7 ± 0.8 - -
Nitrate + acetate - 20 ± 1 31 ± 9 1.5 ± 0.4
Biomass treating real
urban wastewater
Only nitrite 29 ± 2 - - -
Nitrite + acetate 29 ± 1 - 57 ± 3 1.9 ± 0.2
Only nitrate - 33.5 ± 0.5 - -
Nitrate + acetate - 34 ± 1 64 ± 4 1.9 ± 0.1
![Page 163: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/163.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
140
9.2.5. Calculations
Nitrogen removal rate (NRR) was calculated as the removal of both substrates
(ammonium and nitrite) without considering the nitrate produced in the anammox reaction.
Conversely, nitrate produced was considered for the calculation of the nitrogen removal
efficiency (NRE), since this parameter is more accurate when talking about N-removal from a
point of view of real implementation. Specific nitrogen removal rate (sNRR) was calculated
with Eq. 9.1.
( ) = (Eq. 9.1)
where, NRR (g N L-1 d-1) is the nitrogen removal rate obtained for each day of operation and
VS (g VS L-1) is the average volatile solids concentration during each period considered.
The application of Eq. 9.1 implied that all the working volume of the reactor (2 L) was
considered to have the same biomass concentration than the sludge bed, which is where the
samples for VS analysis were taken. However, the concentration of biomass was not uniform
along the longitude of the reactor, and furthermore, it was obvious than higher biomass
concentration was present in the sludge bed than in the reactor separator. Thus, Eq. 9.1
intrinsically led to an underestimation of the real value of sNRR.
9.2.6. Fluorescence in situ hybridization (FISH)
Relative abundances of anammox bacteria were analysed by FISH coupled to confocal
laser scanning microscopy (CLSM) as described in Section 4.3.1. of Chapter 4. Specific
probes for Candidatus Brocadia Anammoxidans and Candidatus Kuenenia stuttgartiensis
were 5´-TxRed-labeled and specific probe for Candidatus Brocadia Fulgida was 5´-
ALEXA594-labeled. In addition, a general probe for all anammox microorganisms was 5´-
ALEXA488-labeled. Hybridization protocol and probes are fully described in Section 4.3.1 of
Chapter 4.
9.2.7. Pyrosequencing
Identification of the microbial population was performed using next-generation
sequencing at samples from days 240, 347 and 448 of the reactor operation. DNA extraction,
pyrosequencing settings and bioinformatics applied are described in Chapter 4, Section 4.3.2.
![Page 164: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/164.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
141
Bacterial 16S rRNA variable regions V2-V4 were targeted using the primer pair 515F-909R.
For bacteria biodiversity analysis and phylogenetic classification reads shorter than 100 bps
and larger than 394 bps were trimmed, and the followed methodology is explained in detail in
Section 4.3.2 of Chapter 4. Relative abundances of reads were determined by taxonomic
level. Indices of biological diversity (Shannon), richness (Chao), and rarefaction curves were
calculated for all libraries at 97, 95 and 90% of similitude. Table AI.2.1. and Figs. AI.2.1,
AI.2.2 and AI.2.3 in the Annex I – Section II show the indices of biological diversity and
rarefaction curves, respectively. All these results indicate the libraries were comparable in
terms of abundance percentages and that good coverage of diversity was reached.
9.2.8. Specific analytical methods
Liquid samples from influent and effluent of the UAnSB reactor were withdrawn to
determine ammonium, nitrite and nitrate concentrations three days per week, according to
Section 4.2.1, Chapter 4. Average particle size and particle size distribution were periodically
measured by a laser particle size analysis system (Malvern Mastersizer Series 2600, Malvern
instruments Ltd., UK). Sampling for size analysis was always performed at 145 mm of height
of the UAnSB reactor. Maximum specific anammox activity (SAA) was determined by
measuring the overpressure generated by the anammox sludge in closed bottles according to
the methodology described by Dapena-Mora et al. (2007).
9.3. RESULTS
9.3.1. Operation of the UAnSB reactor at low temperatures
The lab-scale UAnSB reactor was previously operated at high temperature (26–32 °C)
for 325 days treating a low-strength synthetic influent (details of the operation can be found in
Chapter 8). A stable nitrogen loading rate (NLR) of 1.8 ± 0.2 g N L-1 d-1 and nitrogen removal
rate (NRR) of 1.7 ± 0.1 g N L-1 d-1 were maintained for 2 months at 26 °C before the
temperature was directly lowered to 22 °C (day 0 of the present study).
Fig. 9.1.A,B shows the stable long-term operation of the UAnSB reactor when a low-
strength synthetic influent was treated for 350 days. During this period, temperature was
lowered to evaluate the effect of low temperature on the anammox process at mainstream
conditions in the long-term. Firstly, after one month of stable operation at 22 °C, the
![Page 165: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/165.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
142
temperature was gradually lowered until achieving 13 °C on day 35. The day after lowering
the temperature to 13 °C the nitrogen removal rate (NRE) resulted as low as 71% with a clear
decrease in NRR until 1.32 g N L-1 d-1. Nevertheless, despite the initial decrease of anammox
activity, the operation was maintained stable for more than 8 months at 13 °C with an average
NLR of 1.1 ± 0.2 g N L-1 d-1 and NRE of 82 ± 3%. Moreover, on day 280 the temperature was
directly lowered to 11 °C and further maintained until day 350. Despite of operating at such a
low temperature, the anammox activity was not considerably decreased compared to the
operation at 13 °C (Fig. 9.1A) and average values of 0.93 ± 0.05 g N L-1 d-1 and 82 ± 4% of
NLR and NRE were obtained. Furthermore, a specific nitrogen removal rate (sNRR) of 0.09 ±
0.01 g N g-1 VS d-1 was achieved in the UAnSB reactor operating at 11 °C.
The nitrite to ammonium consumption and the nitrate produced to ammonium
consumed ratios were 1.3 ± 0.1 and 0.24 ± 0.08, respectively, during the first 350 days of the
UAnSB reactor operation when synthetic influent was treated. In addition to the stability of
the anammox process, a good effluent quality was achieved with an average effluent nitrogen
concentration of 13 ± 4 mg N L-1 during the operation at 11 °C (Fig. 9.1B).
After achieving a stable performance of the anammox process treating the synthetic
influent at a temperature at 11 °C, a real urban wastewater was treated to study the effect of
real wastewater matrix on the system. The operation of the UAnSB reactor treating real urban
wastewater at 11 ºC is depicted in Fig. 9.1C,D. Between days 350–380 NLR and NRR
gradually decreased, but an abrupt increase was observed on day 382. This increase was not
intentioned but due to a bad characterization of the urban wastewater during days 370–380.
The anammox activity was maintained until day 400 despite of the sudden increase of NLR
on day 382 but, afterwards, a decrease of NLR and NRR started to occur (Fig. 9.1C).
Nevertheless, a stabilization of the rates was observed from day 420 onwards and average
stable values of 0.59 ± 0.05 g N L-1 d-1 of NLR and 0.35 ± 0.06 g N L-1 d-1 of NRR were
achieved during the last month of operation at 11 °C. Furthermore, the sNRR achieved was
0.021 ± 0.003 g N g-1 VS d-1.
![Page 166: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/166.jpg)
Fig. 9.1. Long-term operation of the UAnSB reactor at mainstream conditions. A,B: Synthetic influent treated at 22, 13 and 11 °C; C,D: real
urban wastewater used as influent at 11 °C. NLR: Nitrogen Loading Rate; NRR: Nitrogen Removal Rate; T: Temperature.
Time (Days)0 50 100 150 200 250 300 350
N-S
peci
es (m
g L-1
)
0
10
20
30
40
50
60
70
Ammonium influent (mg L-1)Nitrite influent (mg L-1)
Tem
pera
ture
(ºC
)
10
15
20
25N
LR a
nd N
RR
(g N
L-1
d-1
)
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
TNLRNRR
A
Tem
pera
ture
(ºC
)
10
15
20
25
NLR
and
NR
R (g
N L
-1 d
-1)
0.00.20.40.60.81.01.21.41.61.8
B
C
Time (Days)350 360 370 380 390 400 410 420 430 440 450 460
N-S
peci
es (m
g L-1
)
0
10
20
30
40
50
60
70
Ammonium effluent (mg L-1)Nitrite effluent (mg L-1)Nitrate effluent (mg L-1)
D
Synthetic influent Real urban wastewater
![Page 167: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/167.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
144
When the UAnSB reactor was treating the real urban wastewater, the nitrite to
ammonium consumption ratio increased until 1.4 ± 0.2, while the nitrate produced to
ammonium consumed ratio decreased until 0.21 ± 0.05, comparing with the ratios obtained
with the synthetic influent. Regarding the COD removal, an average value of 50 ± 10% (c.a.
45 mg O2 L-1 removed) was achieved.
Fig. 9.2 shows the trend of the sNRR during the long-term operation of the UAnSB
reactor. A gradually decrease of anammox activity was observed when temperature was
lowered and, moreover, a sharply decrease of the anammox activity was produced when the
synthetic influent was changed to the real urban wastewater. The effect of the temperature on
the anammox process was evaluated by plotting the NRR to a conventional Arrhenius plot
(Fig. 9.3) (R2 = 0.98) and the activation energy (Ea) value obtained was 30 ± 3 kJ mol-1. In
addition, according to an Arrhenius-type equation (Eq. 9.2), a temperature coefficient of θ =
1.043 ± 0.004 was obtained. These calculations were performed by using the NRR values
obtained from the long-term operation with synthetic influent at 22, 13 and 11 °C (data of the
present study) and the NRR achieved at 26 °C in the previous study described in Chapter 8.
Fig. 9.2. Specific nitrogen removal rate (sNRR) during the operation of the UAnSB reactor at
the different temperatures and influents tested. S-22: synthetic influent at 22 °C; S-13:
synthetic influent at 13 °C; S-11: synthetic influent at 11 °C and R-11: real urban wastewater
at 11 °C.
sNR
R (g
N g
-1 V
S d-1
)
0.00
0.03
0.06
0.09
0.12
0.15
S-22 S-13 S-11 R-11
![Page 168: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/168.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
145
Fig. 9.3. Arrhenius plot for the anammox activity achieved in the UAnSB reactor in the long-
term operation at low temperatures. NRR: nitrogen removal rate.
= · (Eq. 9.2)
where, NRR1 (g N L-1 d-1) is the nitrogen removal rate obtained in the long-term operation of
the UAnSB reactor operating at 26, 22, 13 or 11 ºC; NRRref (g N L-1 d-1): is the nitrogen
removal rate obtained in the long-term operation of the UAnSB reactor operating at a
temperature of reference; θ is the temperature coefficient; T1 (ºC) is the temperature at the
long-term operation (26, 22, 13 or 11 ºC); and Tref (ºC) is the temperature chosen as reference.
One of the main differences between synthetic and real urban wastewater was the
presence of organic matter, which could enhance the growth of heterotrophs in the sludge bed.
The maximum heterotrophic activity was evaluated before and after the change from synthetic
influent to real urban wastewater. Two types of tests were performed depending on the
electron donor available for denitrification: (i) tests with an external organic matter addition
(acetate as electron donor) and (ii) tests with the internal organic matter present in the sludge
(i.e. decay products used as electron donors). Both nitrite and nitrate were added as electron
acceptors. Fig. 9.4 shows both, the maximum specific heterotrophic activity and anammox
activity achieved in batch tests performed with biomass from the UAnSB reactor of days 274
and 420, when synthetic and real influent were being treated, respectively.
Temperature (K-1)
0.00330 0.00335 0.00340 0.00345 0.00350 0.00355
ln (N
RR
)
-0.3
-0.2
-0.1
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
ln NRR Arrhenius model
![Page 169: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/169.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
146
Fig. 9.4. Maximum denitrifying activity achieved when different substrates were used in
batch tests performed in bottles maintained at 30 °C. Biomass used was either treating a
synthetic influent at 13 °C (day 274) or treating real urban wastewater at 11 °C (day 420).
Overall, anammox activity was considerably higher than heterotrophic activity for
both biomass samples. On the one hand, heterotrophic activity was barely observed in tests
with biomass treating the synthetic wastewater, except for the test with nitrite and internal
organic matter. On the other hand, heterotrophic activity was observed in tests with biomass
treating the real urban wastewater when nitrate was used as electron acceptor. Hence,
heterotrophic activity was 0.027 ± 0.004 g N L-1 d-1 when nitrate and acetate were used as
substrates and 0.034 ± 0.009 g N L-1 d-1 when nitrate was used as the only substrate.
Conversely, heterotrophic activity was barely detected when nitrite was used as a substrate
with biomass treating the real wastewater. In any case, the batch tests demonstrated that
maximum heterotrophic activity was 3-times lower than the maximum anammox activity for
samples of biomass treating the real urban wastewater.
9.3.2. Physicochemical characterization of the sludge bed
Biomass concentration in the sludge bed of the UAnSB reactor was maintained stable
during the whole operation treating the synthetic influent, with an average value of 10 ± 1 g
VS L-1. Total solids concentration was also stable with an average value of 13 ± 1 g TS L-1.
Bio
mas
s ac
tivity
(g N
g-1
VS
d-1
)
0.0
0.1
0.2
0.3
0.4
0.5
0.6Biomass treating a syntheticinfluentBiomass treating a realwastewater
Ammonium+
Nitrite
OnlyNitrite
OnlyNitrate
Nitrite+
Acetate
Nitrate+
Acetate
Heterotrophic ActivityAnammoxActivity
![Page 170: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/170.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
147
Conversely, when the real influent was treated, both VS and TS increased until average values
of 16.8 ± 0.5 g VS L-1 and 22.8 ± 0.9 g TS L-1. The solids concentration in the effluent was
maintained stable during the whole operation of the reactor (including synthetic and real
influent) with an average value of (8 ± 6 mg TS L-1) despite the real influent had a high
content of solids (10 ± 3 mg TS L-1) compared with the synthetic influent. Regarding the
settling properties of the granules, the settling velocity and the sludge volumetric index at 5
min were maintained through the whole operation with average values of 41 ± 6 m h-1 and 30
± 10 ml g-1 TS, respectively. A picture of the granules is depicted in Fig. 9.5.
Fig. 9.5. Image of the granules of the UAnSB reactor over a petri dish.
The granule size was measured throughout the whole operation of the UAnSB reactor
(Fig. 9.6B). During the first 300 days of operation the mean granule diameter was maintained
in 820 ± 70 µm, however between days 300–400 a drop in granule size was observed until
reaching a diameter as low as 368 µm on day 392. Then, the granule diameter started to
increase until achieving a mean value of 800 ± 80 µm during the last month of the operation
of the UAnSB reactor. In addition, Fig 9.7 shows the distribution of the granule diameter of
samples from days 199, 373, 410 and 436, which corresponded with the period when the
mean granule diameter presented more deviations as it is shown in Fig. 9.6B. On day 199 the
unimodal shape confirmed that there was mainly one type of granule; then, on days 373 and
410 the granule size was low and two main sizes of granules were observed (two peaks in Fig.
9.7); finally on day 436 the granulation was recovered and the unimodal shape was obtained
again.
![Page 171: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/171.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
148
Fig. 9.6. Upflow velocity (A) and granule diameter (B) evolution during the long-term
operation of the UAnSB reactor.
Since the real urban wastewater used as influent came from a WWTP of an industrial
area, the presence of toxic or inhibitor compounds, which could be accumulated in the sludge
of the UAnSB reactor, was a concern. Actually, the industrial activity of the area where the
urban WWTP was located made the urban wastewater used as influent susceptible to present
metals. Hence, a general screening of the most common elements present in sludge samples
from days 0 and 423 was done (Table AII.1.1 of Annex II). Table 9.3 shows the most
abundant metals found in the sludge.
Time (Days)0 100 200 300 400
Aver
age
gran
ule
diam
eter
m
0
200
400
600
800
1000
Frac
tion
of p
artic
les
(%)
0
20
40
60
80
100
Average granule diameter (m)Fraction of particles with diameter bigger than 200 m Fraction of particles with diameter smaller than 200 m
Upf
low
vel
ocity
(m h
-1)
0.00.20.40.60.81.01.2 A
B
![Page 172: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/172.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
149
Fig. 9.7. Evolution of the granule diameter distribution during the operation of the UAnSB
reactor at mainstream conditions.
Table 9.3. Most abundant metals found in samples of granular biomass from inoculum (day
0, synthetic influent) and from day 423 (real urban wastewater). The results are shown in
micrograms of metal per gram of lyophilised biomass.
Element Day 0 Day 423 Units
Zn 181 1882 µg g-1
Sr 52 455 µg g-1
Ba 28 266 µg g-1
Cu 73 350 µg g-1
Ni 68 114 µg g-1
Sn <5 266 µg g-1
Pb <5 37 µg g-1
Co 5 45 µg g-1
Granule diameter (m)
1 10 100 1000 10000
Vol
ume
of p
artic
les
(%)
0
2
4
6
8
10
12
Day 199 Day 373Day 410Day 436
![Page 173: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/173.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
150
9.3.3. Microbial characterization of the sludge bed
Biomass samples from days 27 (22 °C, synthetic influent), 240 (13 °C, synthetic
influent), 347 (11 °C, synthetic influent), 400 (11 °C, real wastewater) and 448 (11 °C, real
wastewater) were analysed by using the FISH-CLSM technique to determine the enrichment
in anammox bacteria during the long-term operation of the UAnSB reactor at mainstream
conditions.
Regarding the FISH-CLSM analysis performed when the synthetic influent was used,
Candidatus Brocadia anammoxidans was found to be the predominant microbial species
identified in the sludge bed, although its abundance decreased when temperature decreased
(Fig. 9.8). Thus, the inoculum (26 °C) contained a 93 ± 2% of Candidatus Brocadia
anammoxidans and this percentage gradually decreased until 38 ± 5% on day 347 (11 °C).
The anammox species Candidatus Kuenenia stuttgartiensis appeared in all the samples
analysed with abundance always lower than 10%, and no change on this trend was observed
when temperature decreased. The third anammox species identified was the Candidatus
Brocadia fulgida. The higher abundance of this species (24 ± 3%) was found on day 240 (13
°C) and then, when temperature was lowered to 11 °C (day 347) its abundance decreased until
15 ± 2%. The presence of Candidatus Brocadia fulgida was not analysed neither in the
inoculum nor on day 27 because the contributions of Candidatus Brocadia anammoxidans
and Candidatus Kuenenia stuttgartiensis already covered almost the entire microbial
population.
When the synthetic influent was replaced by the real urban wastewater but the UAnSB
reactor continued operating at 11 °C, the abundance of the Candidatus Brocadia
anammoxidans decreased from 38 ± 5% (day 347) to 27 ± 3% (day 400). However, the
abundance of this species was maintained throughout the continuous operation of the UAnSB
reactor treating real urban wastewater at 11 °C with an average value of 30 ± 6% of the total
population (Fig 9.8). In the case of the Candidatus Kuenenia stuttgartiensis, the abundance
was maintained as low as in the biomass samples from the synthetic influent. Regarding the
Candidatus Brocadia fulgida, its abundance decreased during the long-term operation of the
UAnSB reactor treating real urban wastewater at 11 °C, with a 3 ± 1% of abundance on day
448.
![Page 174: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/174.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
151
Fig. 9.8. Anammox species identified by the FISH-CLSM analysis performed on the granular
sludge during the long-term operation of the UAnSB reactor. Candidatus Brocadia fulgida
was not analysed in samples of days 0 (inoculum) and 27. Days 27, 240 and 347 corresponded
to the treatment of the low-strength synthetic influent, while days 400 and 448 corresponded
to the treatment of the real urban wastewater (WW).
FISH-CLSM was also used to quantify the abundance of all anammox bacteria in the
biomass samples by using a general probe (AMX368; Table 4.1, Chapter 4) with specificity
for all the anammox microorganisms. Hence, Fig. 9.9 shows the abundance of all anammox
bacteria versus the sum of abundances of Candidatus Brocadia anammoxidans, Candidatus
Kuenenia stuttgartiensis and Candidatus Brocadia fulgida. On days 0 and 27 the sum of
species identified was close to 100% and, thus, the general anammox abundance with the
general probe was not assessed. Fig. 9.9 shows that (i) the abundance of anammox bacteria
was maintained higher than 80% in the sludge bed of the UAnSB reactor when the synthetic
influent was treated (even at 11 °C) and it decreased until 72 ± 6% (day 448) in the long-term
operation at 11 °C treating a real urban wastewater, and (ii) the sum of the different anammox
species analysed compared to the total anammox bacteria identified with the general probe
differed when temperature was lowered to 11 °C. This difference was maintained when the
real urban wastewater was used as influent. This could mean that at least one anammox
Rel
ativ
e A
bund
ance
(%)
0
20
40
60
80
100
Candidatus Brocadia anammoxidansCandidatus Brocadia fulgida Candidatus Kuenenia stuttgartiensis
DAY 27(22 ºC)
DAY 347(11 ºC)
DAY 400(11 ºC)
Synthetic influent Real urban WW
DAY 240(13 ºC)
DAY 448(11 ºC)
DAY 0(26 ºC)
![Page 175: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/175.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
152
species, which was not previously identified in the biomass samples (different from the
analysed ones), appeared in the reactor when temperature decreased to 11 °C.
Fig. 9.9. Comparative of the abundance of anammox bacteria identified with the general
probe by FISH-CLSM versus the sum of abundances of the species Candidatus Brocadia
anammoxidans, Candidatus Kuenenia stuttgartiensis and Candidatus Brocadia fulgida. The
general probe for all anammox was not used in sample of days 0 (inoculum) and 27. Days 27,
240 and 347 corresponded to the treatment of the low-strength synthetic influent, while days
400 and 448 corresponded to the treatment of the real urban wastewater (WW).
In addition to the FISH-CLSM analysis, pyrosequencing technique was used to
examine the microbial community developed in the UAnSB reactor after the long-term
operation at low temperatures treating the synthetic influent at days 240 (13 °C) and 347 (11
°C) and also the microbial community developed after the change of influent to a real
wastewater at day 488 (11ºC).
Regarding the anammox population, Candidatus Brocadia was the most abundant
genus with a relative abundance of 61% of the total reads on sample from day 240, which
corresponded to the long-term operation treating the synthetic influent at 13 °C (Fig. 9.10).
However, its abundance decreased to 13% on sample from day 347 (operation at 11 °C) and
resulted as low as 5% on sample from day 448, after the long-term operation treating a real
urban wastewater at 11 °C. The genus Candidatus Kuenenia only appeared with an abundance
Rel
ativ
e A
bund
ance
(%)
0
20
40
60
80
100
All anammox species (general anammox probe)Contribution of the different anammox species analysed
Synthetic influent Real urban WW
DAY 27(22 ºC)
DAY 347(11 ºC)
DAY 400(11 ºC)
DAY 240(13 ºC)
DAY 448(11 ºC)
DAY 0(26 ºC)
![Page 176: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/176.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
153
of 3% on sample from day 347. In addition, abundances of 15 and 7% on samples from days
240 and 347, respectively, were identified as Planctomycetes phylum, which is the phylum
that anammox microorganisms belong to. Furthermore, on samples from days 347 and 448
there was a high abundance of reads which were unclassified at genus level (classified as
bacteria at kingdom level). The centroid sequence from this unclassified selection
(corresponding to abundances of 27% and 26% of total reads on samples of days 347 and 448,
respectively) was run against BLAST and matched to the OTU B-3 found by Yamagishi et al.
(2013) in the clone library analysis of a sample from a biofilm developed in a swine
wastewater treatment facility with presence of anammox bacteria. Nonetheless, the reported
study did not affiliate the OTU B-3 with any cultured bacteria.
Fig. 9.10. Microbial diversity at genus level on days 240 (S–13°C: synthetic influent at 13°C),
347 (S–11°C: synthetic influent at 11°C) and 448 (R–11°C: real urban wastewater at 11°C).
Relative abundance was calculated only considering those microorganisms in which the
number of 16S copies was higher than 0.5% of the total copies.
DAY 240(S - 13 ºC)
DAY 347(S - 11 ºC)
DAY 448(R - 11 ºC)
Relative abundance at genus level (%)0 20 40 60 80 100
Unclassified (Rhodospirillales Order)Unclassified (Cytophagales Order) MassiliaUnclassified (Rhodocyclales Order)Thermomonas MesorhizobiumPlanococcusOthers (Abundance <1%)No Hit
Candidatus Brocadia Candidatus KueneniaUnclassified (Planctomycetes Phylum) Denitratisoma Unclassified (Bacteria Kingdom) IgnavibacteriumUnclassified (Burkholderiales Order)Unclassified (Xanthomonadales Order)Unclassified (Opitutales Order) Unclassified (Acidobacteriales Order)
![Page 177: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/177.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
154
Regarding other abundant genera present in biomass samples from the UAnSB reactor,
Denitratisoma genus was found through the entire operation of the UAnSB reactor and,
moreover, its abundance gradually increased during the operation, resulting in 14, 18 and 20%
of the total reads on samples from days 240, 347 and 448, respectively. More specifically, the
OTU identified corresponded to the Denitratisoma oestradiolicum species, which has been
reported as heterotrophic denitrifying bacteria capable of using either nitrite or nitrate as
electron acceptors (Fahrbach et al., 2006). In addition, the Ignavibacterium genus appeared on
sample from day 347 when synthetic influent was treated with an abundance of 1% of total
reads, which increased until 6% when the real urban wastewater was treated. Ignavibacterium
genus was reported as a heterotrophic denitrifier capable of using nitrite but not nitrate as
electron acceptor (Ramos et al., 2016).
9.4. DISCUSSION
9.4.1. Effect of low temperature on the anammox activity
The effect of the temperature decrease on the long-term operation of the UAnSB
reactor was evaluated when a synthetic influent mimicking municipal wastewater was treated.
A stable operation at high NLR and NRR with a good quality of effluent was achieved at any
of the temperatures tested (Fig. 9.1A). Nevertheless, a considerable decrease of the specific
anammox activity was observed when temperature decreased (Fig. 9.2). In fact, a decrease of
28% of anammox activity occurred when temperature decreased from 22 to 13 °C. The
unfavourable effect when temperature falls below 15 °C was previously observed in
anammox systems (Laureni et al., 2015) and, even more, many systems operating at
temperatures below 15 °C triggered to the destabilization of anammox process either in one-
stage (Laureni et al., 2016; Lotti et al., 2014a) or two-stage systems (Jin et al., 2013; Sánchez
Guillén et al., 2016). When temperature was lowered to 11 °C, anammox activity only
decreased a 10% compared to activity at 13 °C, which could be explained by the adaptation of
anammox biomass to low temperatures during the operation of the UAnSB reactor at 13 °C
for more than 200 days. In fact, anammox biomass was reported to experiment adaptation to
low temperatures (Dosta et al., 2008; Hu et al., 2013; Lotti et al., 2015c).
The effect of temperature on the anammox activity was successfully described
according to the Arrhenius equation for the range of temperatures 26–11 °C (Fig. 9.3). Thus,
![Page 178: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/178.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
155
the temperature dependency was described by one activation energy (Ea) and a single
temperature coefficient (θ). This result differed from the reported by Lotti et al. (2015c)
where different temperature dependencies were observed at different temperature intervals
between 30–10 °C: the lower the temperature the higher the temperature dependency was.
Moreover, the value of Ea (30 ± 3 kJ mol-1) obtained was lower to that reported by Lotti et al.
(2015c) for different anammox sludge and to that reported elsewhere, no matter if biomass
adapted or not adapted to low temperature was used (Dapena-Mora et al., 2007; Hendrickx et
al., 2012, 2014; Strous et al., 1999). The low value of Ea obtained implies that the anammox
biomass of the present study had more resilience to temperature changes than those
previously reported. This could be due to the fact that the reported studies performed short-
term activity tests to determine the anammox activity; while in the present study anammox
activity was measured after long-term operation at each temperature. Hence, it could be
suggested that the anammox adaptation at each temperature helped to face the next
temperature change, avoiding the temperature shock imposed to anammox activity when
performing short-term tests. Furthermore, the low value of the temperature coefficient
obtained (1.043 ± 0.004) demonstrated a low temperature dependency of the anammox
biomass developed in the UAnSB reactor of the present study. In fact, the temperature
coefficient value was in the range of the reported for heterotrophic denitrifiers (Carrera et al.,
2003). These results suggest that anammox bacteria cannot be regarded anymore as
intrinsically highly resilient to low temperatures. In the same way, Lotti et al., (2015b)
recently published a study which demonstrated that anammox bacteria cannot be regarded
anymore as an intrinsically slow growing microorganism, because the maximum growth rate
can be increased when adequate cultivation conditions are imposed. Thus, possibilities for
bioprocess design, such as the volume of the bioreactors, should take into consideration these
recently results obtained in anammox cultures, especially for the implementation of anammox
process in the mainstream of urban wastewater treatment plants.
In addition to the stable operation of the UAnSB reactor for more than 300 days at
temperatures lower than 15 °C, high nitrogen removal rates were achieved in comparison to
other similar systems. Hence, a NRR of 0.86 ± 0.07 g N L-1 d-1 was achieved at 11 °C, which
was at least one order of magnitude higher than the reported for other anammox systems,
either in one or two-stage systems operating at low temperature with synthetic wastewater
(Gilbert et al., 2014; Sánchez Guillén et al., 2016). Furthermore, the nitrite to ammonium
consumption ratio and the nitrate produced to ammonium consumed ratio obtained when the
![Page 179: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/179.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
156
synthetic influent was treated at low temperature were close to the previously reported for
anammox cultures (Lotti et al., 2014c; Strous et al., 1998) and confirmed that anammox was
the main process taking place in the UAnSB reactor (i.e. heterotrophic denitrification was
negligible). In fact, heterotrophic denitrification was not expected to be significant in the
system since no organic carbon was present in the influent and if any, it could be only
expected by the use of the decay-products.
Additionally to the decrease in anammox activity, low temperatures affected the size
of anammox granules: granule diameter sharply decreased when temperature decreased to 11
°C (Fig. 9.6B). It could be thought that the diameter decrease was due to a different parameter
rather than temperature, such as the lost of activity or changes in the liquid upflow velocity
(Vup). In fact, Vup was demonstrated to be a key parameter in the granulation and operation of
UASB reactors (Arne Alphenaar et al., 1993; Liu and Tay, 2002). In this sense, an exhaustive
study of the influence of Vup on the performance of the UAnSB reactor was presented in
Chapter 8. It was previously demonstrated (Section 8.3.2.1, Chapter 8) that values of Vup
lower than 0.4 m h-1 led to losing granulation when reactor operated at 26 °C while higher
values enhanced granulation. For VupS higher than 0.8 m h-1 granule diameter stabilized with
no further increase. Thus, with the purpose of avoiding the deterioration of the granulation in
the sludge bed of the UAnSB reactor of the present study, Vup was maintained at an average
value of 0.48 ± 0.09 m h-1 (Fig 9.6A). Regarding the effect of activity, granule size increased
at the end of the operation of the UAnSB reactor when the real influent was treated until
recovering the original diameter (800 ± 80 µm). At this point, the anammox activity was the
lower one of the whole operation, so the changes in granule size could not be associated to
anammox activity but to other parameters, such as temperature. In contrast, Lotti et al.
(2014b) reported an increase of granule diameter from 1.5 to 2.1 mm when temperature
decreased from 20 to 10 °C.
Regarding the microbial characterization, FISH analysis demonstrated the preservation
of a high anammox enrichment during the entire operation treating the synthetic influent at
low temperatures, which could explain the high stability of the anammox process in the
UAnSB reactor. The decrease of the most abundant species, Candidatus Brocadia
anammoxidans, was observed in favour of the appearance of Candidatus Brocadia fulgida
after the long-term operation at 13 °C (Fig. 9.8). Candidatus Brocadia fulgida was reported to
be the dominant anammox species in anammox reactors operating at low temperature
(Hendrickx et al., 2014; Laureni et al., 2015; Lotti et al., 2014b). Thus, the role of Candidatus
![Page 180: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/180.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
157
Brocadia fulgida under mainstream conditions was further supported by this study, which
suggests that this species could have a competitive advantage at low temperatures. Actually, it
also supports the fact that microbial ecology was determined by the influent and bulk liquid
substrate concentrations, rather than the inoculum used (Park et al., 2010). When temperature
decreased to 11 °C, all the anammox species identified by FISH decreased (even the
Candidatus Brocadia fulgida, Fig. 9.8) in agreement with the pyrosequencing analysis which
showed a significant decrease of Candidatus Brocadia genus (Fig. 9.10). However, general
anammox bacteria abundance was maintained according to the FISH results (Fig. 9.9), which
could suggest that different anammox species with high adaptation to low temperature
appeared in the sludge bed of the UAnSB reactor. In fact, a high abundance of unclassified
bacteria were found by pyrosequencing on sample from day 347, and the anammox species
not identified could be part of it. It could be hypothesised that for example Candidatus
Anammoxoglobus propionicus appeared in the sludge bed, since Gonzalez-Martinez et al.
(2016) reported the appearance of Candidatus Anammoxoglobus propionicus and the
decreasing of Candidatus Brocadia species in a CANON reactor when temperature was
lowered from 35 to 25 °C; they suggested that the former could have a higher tolerance to low
temperatures than the later.
9.4.2. Effect of the real urban wastewater on the anammox activity
The effect of treating a real urban wastewater at 11 °C at long-term in the UAnSB
reactor was evaluated. The replacement of the synthetic influent by the real urban wastewater
led to a considerable decrease of anammox activity (Fig. 9.2). However, a stable operation
was achieved with an average NRR of 0.59 ± 0.05 g N L-1 d-1 during the last month of
operation (Fig. 9.1C). The NRR achieved was considerably higher compared to other
anammox systems treating a real influent at low temperatures. For instance, Laureni et al.
(2015) reported a NRR of 0.046 g N L-1 d-1 in an anammox sequencing batch reactor (SBR)
operating at 12.5 °C and Hendrickx et al. (2014) reported a NRR of 0.027 g N L-1 d-1 in a gas-
lift anammox reactor operating at 10 °C, which are one order of magnitude lower than the
achieved in the present study. Besides, for a one-stage system Laureni et al. (2016) reported a
maximum anammox activity of 0.1 g N L-1 d-1 in a PN/A SBR reactor operating at 15 °C with
an almost complete suppression of anammox activity at 11 °C. The NRR achieved in the
present study was only comparable to the achieved by Lotti et al. (2014b) in a lab-scale
upflow fluidized granular sludge anammox reactor at 10 °C, which resulted in a NRR of 0.43
![Page 181: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/181.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
158
g N L-1 d-1. Furthermore, to the best of the author’s knowledge, the average NRR obtained in
this study (0.59 ± 0.05 g N L-1 d-1) was the highest NRR reported hitherto at 11 °C treating a
real urban wastewater.
The decrease of anammox activity in the UAnSB reactor when the synthetic influent
was replaced by the real urban wastewater was not explained by the temperature effect,
because temperature was already maintained at 11 °C for 70 days previous to the use of real
wastewater. Hence, the lower anammox activity achieved when the real urban wastewater was
treated should be associated to other factors rather than temperature such as: (i) the
competition for nitrite of anammox bacteria with heterotrophs, (ii) the shift or decrease of
anammox population and/or (iii) the presence of potential toxic or inhibitoring compounds for
anammox bacteria in the real urban wastewater.
The presence of organic matter in the real urban wastewater (Table 9.1) could lead to
the growth of heterotrophic bacteria which could use the nitrite and nitrate present in the bulk
liquid as electron acceptors to perform heterotrophic denitrification in the UAnSB reactor
(Henze et al., 2008; Liu et al., 2007). The destabilization of anammox process due to the
competition for nitrite between anammox and heterotrophs was reported before. Chen et al.
(2016) studied the effect of increasing the ratio between the concentrations of COD and total
nitrogen (COD/N ratio) on anammox activity and observed the suppression of anammox
activity when the ratio was higher than 1.6 in a lab-scale anaerobic buffer reactor at 30 °C.
Similar results were reported by Lackner et al. (2008) with a modelling study of a PN/A
biofilm system where anammox process could not be sustained at COD/N ratios higher than
2.
In the present study, heterotrophic activity tests and pyrosequencing analysis
demonstrated the presence of heterotrophs in the sludge bed of the UAnSB reactor during the
entire operation. The biomass treating synthetic wastewater showed the highest heterotrophic
activity when nitrite was used as electron acceptor and the decay products were used as
electron donors (Fig. 9.4). This was expected since biomass was used to grow on decay
products since influent was devoid of carbon source. In fact, when an external organic matter
addition was used, the heterotrophic activity was as low in the nitrite batch test as in the
nitrate batch test. The reason why nitrite was preferred over nitrate was unexpected and
unclear, since nitrate was always present in the bulk liquid while anammox bacteria were
expected to won the competition for nitrite. Conversely, when biomass was treating the real
urban wastewater, the heterotrophic activity tests showed that denitrification via nitrite was
![Page 182: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/182.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
159
not relevant compared to denitrification via nitrate (Fig. 9.4). It could be surmised, that
heterotrophic bacteria present in the sludge bed were not used to consume nitrite as electron
acceptor due to the fact that anammox won the competition by nitrite in the UAnSB reactor.
However, nitrate was always available for denitrifiers and, thus, heterotrophic bacteria could
be used to consume nitrate rather than nitrite. Likewise, when the real urban wastewater was
treated, the nitrite to ammonium consumption ratio barely increased while the nitrate
produced to ammonium consumed ratio considerably decreased comparing with the ratios
obtained with the synthetic influent and the corresponding ratios observed for anammox
bacteria (Lotti et al., 2014c; Strous et al., 1998). This meant that a slight more nitrite
consumption and a considerably more nitrate consumption than the expected by anammox
bacteria occurred in the reactor. Hence, heterotrophic bacteria denitrified nitrite and nitrate
and competed with anammox bacteria, which was expected since a COD removal of 50 ±
10% (c.a. 45 mg O2 L-1 removed) was achieved in the UAnSB reactor when the real urban
wastewater was treated. In fact, pyrosequencing results confirmed the presence of two
denitrifiers which are able to consume nitrite and/or nitrate: Denitratisoma and
Ignavibacterium genus. In any case, the heterotrophic denitrification via nitrate was useful to
remove the nitrate produced by anammox and, thus, helped to guarantee a good effluent
quality. Hence, the presence of heterotrophs in the sludge bed of the UAnSB reactor is
expected to be useful as long as they do not outcompete anammox bacteria. Nevertheless,
activity tests showed that heterotrophic denitrification was considerably lower than the
autotrophic denitrification via anammox (Fig. 9.4), so anammox were expected to win the
competition for nitrite against heterotrophic bacteria.
The prevalence of anammox activity over heterotrophic denitrification was reported
before in anammox reactors treating real urban wastewater. For example, Laureni et al. (2015)
reported that anammox bacteria won competition against heterotrophs in the long-term in a
SBR operating at 29 ºC where, despite the addition of different carbon sources, nitrite was
only removed when ammonium was spiked. The same result was reported by Malovanyy et
al. (2015) in an integrated fixed film activated sludge (IFAS) reactor operating at 25 ºC,
where an influent with a COD/N concentrations ratio of 1.8 guaranteed that the anammox
outcompeted heterotrophs. Hence, the high decrease in anammox activity when the real urban
wastewater was treated in the UAnSB reactor at 11 °C was not explained by the competition
with heterotrophic bacteria.
![Page 183: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/183.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
160
A decrease in anammox population could cause the loss of activity when the synthetic
influent was replaced by the real urban wastewater. Pyrosequencing analysis showed a
significant decrease in anammox population with only 5% of the total reads identified as
Candidatus Brocadia genus (Fig. 9.10) when the real urban wastewater was treated.
Conversely, FISH results showed a highly enrichment in anammox bacteria (72 ± 6%) in the
sludge bed of the UAnSB reactor despite of the decrease of abundance compared with the
synthetic influent treatment (Fig. 9.9). This difference may be explained considering that
FISH technique points toward the abundance of rRNA in samples, while pyrosequencing
points toward the abundance of DNA (Wittebolle et al., 2005). Thus, the microbial diversity
present in the sludge bed when the real wastewater was treated could be detected by
pyrosequencing although the activities of some of these microbes in the reactor were low or
null, which would contribute to decrease the relative abundance of anammox bacteria. Hence,
it could be hypothesised that a change in the anammox species instead of the decrease of
anammox population could cause the activity decrease. Actually, the decrease in temperature
to 11 °C led to the appearance of one single or more anammox species which were not
identified by the molecular techniques used and were maintained during the entire operation
with the real urban wastewater. The hypothesis of the presence of Candidatus
Anammoxoglobus propionicus could be considered since it was reported to consume small
organic acids such as acetate and propionate in the presence of ammonium (Kartal et al.,
2007), which could give them an adaptive advantage when organic matter is present.
Nevertheless, further molecular techniques should be applied to identify the anammox species
that could have appeared in the sludge bed. In any case, it could be surmised that the
anammox species that appeared in the sludge bed had a lower growth rate and activity than
the previous species identified in this work, which could explain the decrease of activity in the
UAnSB reactor.
The presence of toxic or inhibitory compounds for anammox bacteria in the real urban
wastewater could also explain the decrease of activity in the reactor when influent changed
from synthetic to real influent. Trace amounts of some metals are components of many
enzymes or co-enzymes and play an important role in the microbial metabolism, however
high concentrations can cause inhibition and can be even toxic (Yang et al., 2013). Sludge
elemental analysis showed a high accumulation of metals in the granular sludge after treating
the real wastewater compared with the inoculum (Table 9.3). The inhibitory effect of metals
on anammox bacteria was previously demonstrated (Bi et al., 2014). Besides, Lotti et al.
![Page 184: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/184.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
161
(2012) reported a considerable decreased in anammox activity caused by the prolonged
exposure to copper (Cu), and Li et al. (2015) reported inhibition after short-term exposure to
Cu and zinc (Zn). Furthermore, Li et al. (2015) determined nickel (Ni) as moderately toxic
while lead (Pb) was poorly toxic for anammox bacteria. The mentioned studies reported
inhibition of anammox bacteria in presence of metals dissolved in the bulk liquid, however
little has been published about the effect of the accumulation of heavy metals in the anammox
granules. In this sense, it was reported that an accumulation of Cu in anammox granules
caused disorders in metabolic pathways affecting to the energy metabolism and cell synthesis,
which led to the suppression of anammox activity (Zhang et al., 2016a, 2015). Still, biomass
adaptation to the presence of inhibitors could be hypothesised in the UAnSB reactor in the
long-term, which could explain the anammox activity decrease during the first days of
treating the real urban wastewater and the subsequent stabilization in the long-term operation.
In fact, Zhang et al. (2016b) suggested that anammox biomass gain self-adaptation to Cu
through acclimation (e.g. secreting more EPS for self-protection).
In addition to the accumulation of metals, there was an increase in the solids content of
the sludge bed, which could not be explained just because of the growth of the biomass, even
though considering the growth of heterotrophs, and it was probably due to the retention of
solids of the influent in the sludge-bed. This retention of solids could have two opposite
implications: (i) if low, it could help granulation and (ii) if high, it could lead to a high
inorganic content in the granules leading to destabilization of granulation. As mentioned
before, the granule size increased after some time treating the real urban wastewater despite of
the temperature was maintained at 11 °C. Thus, it could be hypothesized that the use of urban
wastewater with high solids content enhanced the granulation due to different factors such as
the addition of inert nuclei for bacterial attachment and/or the probable excess of EPS
produced by anammox bacteria due to the stress associated to the income of organic matter
with the real influent (Liu et al., 2003). Nevertheless, the excessive increase of inorganic
compounds could reduce the available space for biomass growth, could affect the biomass
activity if such compounds were at the same time toxic or inhibitors as previously mentioned
and could affect to the internal mass transfer of substrates.
The reason why the anammox activity decreased when the real urban wastewater was
treated in the long-term at 11 °C was unclear, but it could be the combination of the above-
mentioned hypothesis. Other similar studies tried to explain the decrease of anammox activity
when a real urban wastewater was treated with different hypothesis. On the one hand, causes
![Page 185: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/185.jpg)
Chapter 9. Stable long-term operation of an anammox UASB reactor at mainstream conditions
162
for the anammox activity suppression at 11 °C in a PN/AMX SBR remained unclear in
Laureni et al. (2016) and they suggested that further investigation would be needed for
elucidating the mechanisms that limited anammox activity in such system. On the other hand,
Laureni et al. (2015) performed an extensive study to elucidate the causes of anammox
activity decrease and reported that neither the heterotrophic competition for nitrite nor the
shift of anammox population explained the adverse effects observed in anammox activity in a
SBR treating a pre-treated municipal wastewater, and suggested that anammox population
needed acclimation to the real influent and/or the development of a side population beneficial
to it.
9.5. CONCLUSIONS
A stable long-term operation of the UAnSB reactor was maintained at high nitrogen
removal rates, both treating a synthetic low-strength influent and treating a real urban
wastewater at 11 ºC.
The decrease of temperature caused a decrease in anammox activity, however the
anammox bacteria showed an adaptation at each temperature tested, which helped to face the
next temperature change.
The enrichment of the sludge bed in anammox bacteria was maintained during the long-
term operation. However, the abundance of the most abundant species (Candidatus Brocadia
anammoxidans) decreased when temperature decreased, and unidentified anammox species
appeared in the microbial community.
Anammox bacteria were expected to win the competition for nitrite with the heterotrophs
present in the sludge bed, since anammox activity was always considerably higher than
heterotrophic activity.
The presence of inhibitors and/or toxic compounds and the high solids content in the real
urban wastewater used as influent was suggested to adversely affect the anammox activity.
![Page 186: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/186.jpg)
Chapter 10
GENERAL CONCLUSIONS
![Page 187: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/187.jpg)
Chapter 10. General Conclusions
164
![Page 188: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/188.jpg)
Chapter 10. General Conclusions
165
The main objective of the present thesis was accomplished, since the feasibility of
operating a two-stage system for performing the autotrophic biological nitrogen removal at
mainstream conditions was demonstrated through the partial nitritation and anammox reactors
successfully running in the long-term.
Hence, two blocks of conclusions can be stated considering the partial nitritation and
anammox processes separately:
- Partial nitritation process at mainstream conditions
A granular sludge airlift reactor was successfully operated at 10 °C performing
stable partial nitritation of a synthetic influent in the long-term.
High nitrogen removal rates and an adequate effluent for a subsequent anammox
reactor were obtained.
NOB repression was effectively achieved, being the nitrate production barely
detected in the bulk liquid of the airlift reactor.
Microbial characterization of the developed biomass demonstrated that the sludge
was highly enriched in AOB, while NOB genera were hardly detected.
Furthermore, the presence of a heterotrophic population was found in the sludge.
The nitrifier culture enriched in AOB presented high values of the kinetic
parameters µmax and KS,TAN compared to other studies, which could explain the
high nitritation rates obtained in the reactor, which were advantageous for NOB
repression.
Nitrous oxide emissions from the granular airlift reactor performing partial
nitritation at mainstream conditions were low compared to the emissions from
reactors treating high-strength influents.
A dependence of nitrous oxide production with temperature was observed,
resulting the higher the temperature the higher the N2O production.
![Page 189: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/189.jpg)
Chapter 10. General Conclusions
166
- Anammox process at mainstream conditions
The implementation of anammox process in an UAnSB reactor was proposed since
a stable operation was maintained treating an urban wastewater in the long-term.
Liquid upflow velocity was demonstrated to be a key parameter in the
implementation of anammox process in UASB reactors, since it affected to
granulation and external mass transfer. The higher the liquid upflow velocity was
the bigger the granules and the lower the external mass transfer problems were.
High nitrogen removal rates and high nitrogen removal efficiencoes were obtained
in the UAnSB reactor treating an urban wastewater at temperature as low as 11 °C.
The negative effect of the temperature decrease on anammox activity was ratified
when temperature lowered from 22 to 11 °C, however an adaptation of the
anammox bacteria was observed after the long-term operation at each temperature
tested (22, 13, 11 °C).
Microbial characterization of the developed biomass demonstrated that the sludge
was highly enriched in anammox bacteria during the whole operation of the
UAnSB reactor, even at low temperature. Furthermore, Candidatus Brocadia
anammoxidans was the most abundant anammox species in the sludge developed
in the reactor, although its abundance decreased with the temperature decreased.
Microbial characterization of the developed biomass showed the presence of
heterotrophic bacteria. However, anammox activity was always higher than
heterotrophic activity in the UAnSB reactor.
![Page 190: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/190.jpg)
Chapter 11
REFERENCES
![Page 191: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/191.jpg)
Chapter 11. References
168
![Page 192: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/192.jpg)
Chapter 11. References
169
Ahn, J.H., Kim, S., Park, H., Rahm, B., Pagilla, K., Chandran, K., 2010. N2O emissions from activated sludge processes, 2008-2009: results of a national monitoring survey in the United States. Environ. Sci. Technol. 44, 4505–4511. doi:10.1021/es903845y
Ahn, J.H., Yu, R., Chandran, K., 2008. Distinctive microbial ecology and biokinetics of autotrophic ammonia and nitrite oxidation in a partial nitrification bioreactor. Biotechnol. Bioeng. 100, 1078–1087. doi:10.1002/bit.21863
Alm, E. W., Oerther, D. B., Larsen, N., Stahl, D. A., Raskin, L. 1996. The oligonucleotide probe database. Appl Environ Microbiol 62: 3557-9
Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., Stahl, D. A., 1990. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56, 1919-1925.
Andrews, J., Harris, R., 1986. r- and K-Selection and Microbial Ecology. Marshall, K.C. Ed., Advances in Microbial Ecology. Springer US, pp. 99–147. doi:10.1007/978-1-4757-0611-6_3
APHA, 2005. Standard Methods for the Examination of Water and Wastewater. American Water Works Association (AWWA) and Water Environmental Federation (WEF), Washington, DC, USA
Ardern, E., Lockett, W.T., 1914. Experiments on the oxidation of sewage without the aid of filters. J. Soc. Chem. Ind. 33, 523.
Arne Alphenaar, P., Visser, A., Lettinga, G., 1993. The effect of liquid upward velocity and hydraulic retention time on granulation in UASB reactors treating wastewater with a high sulphate content. Bioresour. Technol. 43, 249–258. doi:10.1016/0960-8524(93)90038-D
Awata, T., Goto, Y., Kindaichi, T., Ozaki, N., Ohashi, a., 2015. Nitrogen removal using an anammox membrane bioreactor at low temperature. Water Sci. Technol. 72, 2148–2153. doi:10.2166/wst.2015.436
Bartrolí, A., Pérez, J., Carrera, J., 2010. Applying ratio control in a continuous granular reactor to achieve full nitritation under stable operating conditions. Environ. Sci. Technol. 44, 8930–5. doi:10.1021/es1019405
Bi, Z., Qiao, S., Zhou, J., Tang, X., Cheng, Y., 2014. Inhibition and recovery of Anammox biomass subjected to short-term exposure of Cd, Ag, Hg and Pb. Chem. Eng. J. 244, 89–96. doi:10.1016/j.cej.2014.01.062
Blackburne, R., Vadivelu, V.M., Yuan, Z., Keller, J., 2007. Determination of growth rate and yield of nitrifying bacteria by measuring carbon dioxide uptake rate. Water Environ. Res.
![Page 193: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/193.jpg)
Chapter 11. References
170
79, 2437–2445. doi:10.2175/106143007X212139
Blackburne, R., Yuan, Z., Keller, J., 2008. Partial nitrification to nitrite using low dissolved oxygen concentration as the main selection factor. Biodegradation 19, 303–312. doi:10.1007/s10532-007-9136-4
Bollon, J., Filali, A., Fayolle, Y., Guerin, S., Rocher, V., Gillot, S., 2016. N2O emissions from full-scale nitrifying biofilters. Water Res. 102, 41–51. doi:10.1016/j.watres.2016.05.091
Carrera, J., Vicent, T., Lafuente, F.J., 2003. Influence of temperature on denitrification of an industrial high-strength nitrogen wastewater in a two-sludge system. Water SA 29, 11–16. doi:10.4314/wsa.v29i1.4939
Castro-Barros, C.M., Daelman, M.R.J., Mampaey, K.E., van Loosdrecht, M.C.M., Volcke, E.I.P., 2015. Effect of aeration regime on N2O emission from partial nitritation-anammox in a full-scale granular sludge reactor. Water Res. 68, 793–803. doi:10.1016/j.watres.2014.10.056
Cervantes, F.J., 2009. Environmental Technologies to Treat Nitrogen Pollution, Integrated environmental technology series. IWA Publishing.
Chandran, K., Hu, Z., Smets, B.F., 2008. A critical comparison of extant batch respirometric and substrate depletion assays for estimation of nitrification biokinetics. Biotechnol. Bioeng. 101, 62–72. doi:10.1002/bit.21871
Chen, C., Sun, F., Zhang, H., Wang, J., Shen, Y., Liang, X., 2016. Evaluation of COD effect on anammox process and microbial communities in the anaerobic baffled reactor (ABR). Bioresour. Technol. 216, 571–578. doi:10.1016/j.biortech.2016.05.115
Daelman, M.R.J., van Voorthuizen, E.M., van Dongen, U.G.J.M., Volcke, E.I.P., van Loosdrecht, M.C.M., 2015. Seasonal and diurnal variability of N2O emissions from a full-scale municipal wastewater treatment plant. Sci. Total Environ. 536, 1–11. doi:10.1016/j.scitotenv.2015.06.122
Daims, H., Brühl, A., Amann, R., Schleifer, K.H., Wagner, M., 1999. The domain-specific probe EUB338 is insufficient for the detection of all Bacteria: Development and evaluation of a more comprehensive probe set. Systematic Appl. Microbiol.22, 434-444.
Daims H., Nielsen J. L., Nielsen P. H., Schleifer K. H. and Wagner M., 2001. In situ characterization of Nitrospira-like nitrite-oxidizing bacteria active in wastewater treatment plants. Appl. Environ. Microbiol. 67: 5273-5284.
Dapena-Mora, A., Fernández, I., Campos, J.L., Mosquera-Corral, A., Méndez, R., Jetten, M.S.M., 2007. Evaluation of activity and inhibition effects on Anammox process by
![Page 194: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/194.jpg)
Chapter 11. References
171
batch tests based on the nitrogen gas production. Enzyme Microb. Technol. 40, 859–865. doi:10.1016/j.enzmictec.2006.06.018
De Beer, D., Heuvel, J.C. van den, Ottengraf, S.P.P., 1993. Microelectrode measurement of the activity distribution in nitrofying bacterial aggregates. Appl. Environ. Microbiol. 59, 573–579.
De Clippeleir, H., Vlaeminck, S.E., De Wilde, F., Daeninck, K., Mosquera, M., Boeckx, P., Verstraete, W., Boon, N., 2013. One-stage partial nitritation/anammox at 15 °C on pretreated sewage: feasibility demonstration at lab-scale. Appl. Microbiol. Biotechnol. 97, 10199–210. doi:10.1007/s00253-013-4744-x
De Clippeleir, H., Yan, X., Verstraete, W., Vlaeminck, S.E., 2011. OLAND is feasible to treat sewage-like nitrogen concentrations at low hydraulic residence times. Appl. Microbiol. Biotechnol. 90, 1537–1545. doi:10.1007/s00253-011-3222-6
Desloover, J., De Clippeleir, H., Boeckx, P., Du Laing, G., Colsen, J., Verstraete, W., Vlaeminck, S.E., 2011. Floc-based sequential partial nitritation and anammox at full scale with contrasting N2O emissions. Water Res. 45, 2811–2821. doi:10.1016/j.watres.2011.02.028
Dosta, J., Fernández, I., Vázquez-Padín, J.R., Mosquera-Corral, a, Campos, J.L., Mata-Alvarez, J., Méndez, R., 2008. Short- and long-term effects of temperature on the Anammox process. J. Hazard. Mater. 154, 688–93. doi:10.1016/j.jhazmat.2007.10.082
Ducey, T.F., Vanotti, M.B., Shriner, A.D., Szogi, A. a., Ellison, A.Q., 2010. Characterization of a microbial community capable of nitrification at cold temperature. Bioresour. Technol. 101, 491–500. doi:10.1016/j.biortech.2009.07.091
Edgar, R.C., 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26, 2460–1. doi:10.1093/bioinformatics/btq461
Edgar, R.C., 2013. UPARSE: highly accurate OTU sequences from microbial amplicon reads, Nat. Meth. 10, 996-998.
Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., Knight, R., 2011. UCHIME improves sensitivity and speed of chimera detection, Bioinformatics 27, 2194-2200.
EPA, 2016. Inventory of U.S. Greenhouse Gas Emissions and Sinks: 1990-2014 1–34.
EPA Website (www.epa.gov; August 2016).
Esquivel-Rios, I., Ramirez-Vargas, R., Hernandez-Martinez, G.R., Vital-Jacome, M., Ordaz, A., Thalasso, F., 2014. A microrespirometric method for the determination of stoichiometric and kinetic parameters of heterotrophic and autotrophic cultures. Biochem. Eng. J. 83, 70–78. doi:10.1016/j.bej.2013.12.006
![Page 195: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/195.jpg)
Chapter 11. References
172
Eurostat, 2015. Generation and discharge of wastewater in volume. © European Union. Website: www.ec.europa.eu/eurostat
Fahrbach, M., Kuever, J., Meinke, R., Kämpfer, P., Hollender, J., 2006. Denitratisoma oestradiolicum gen. nov., sp. nov., a 17beta-oestradiol-degrading, denitrifying betaproteobacterium. Int. J. Syst. Evol. Microbiol. 56, 1547–52. doi:10.1099/ijs.0.63672-0
Farges, B., Poughon, L., Roriz, D., Creuly, C., Dussap, C.G., Lasseur, C., 2012. Axenic cultures of Nitrosomonas europaea and Nitrobacter winogradskyi in autotrophic conditions: A new protocol for kinetic studies. Appl. Biochem. Biotechnol. 167, 1076–1091. doi:10.1007/s12010-012-9651-6
Fernández, I., Vázquez-Padín, J.R., Mosquera-Corral, A., Campos, J.L., Méndez, R., 2008. Biofilm and granular systems to improve Anammox biomass retention. Biochem. Eng. J. 42, 308–313. doi:10.1016/j.bej.2008.07.011
Ferrell, R.T., Himmelblau, D.M., 1967. Diffusion coefficients of nitrogen and oxygen in water. J. Chem. Eng. Data 12, 111–115. doi:10.1021/je60032a036
Fitzgerald, C.M., Camejo, P., Oshlag, J.Z., Noguera, D.R., 2015. Ammonia-oxidizing microbial communities in reactors with efficient nitrification at low-dissolved oxygen. Water Res. 70, 38–51. doi:10.1016/j.watres.2014.11.041
Gao, D.-W., Huang, X.-L., Tao, Y., Cong, Y., Wang, X., 2015. Sewage treatment by an UAFB-EGSB biosystem with energy recovery and autotrophic nitrogen removal under different temperatures. Bioresour. Technol. 181, 26–31.
Gao, D.-W., Lu, J.-C., Liang, H., 2014. Simultaneous energy recovery and autotrophic nitrogen removal from sewage at moderately low temperatures. Appl. Microbiol. Biotechnol. 98, 2637–2645. doi:10.1007/s00253-013-5237-7
Ge, H., Batstone, D.J., Keller, J., 2013. Operating aerobic wastewater treatment at very short sludge ages enables treatment and energy recovery through anaerobic sludge digestion. Water Res. 47, 6546–6557. doi:http://dx.doi.org/10.1016/j.watres.2013.08.017
Gieseke, A., Tarre, S., Green, M., De Beer, D., 2006. Nitrification in a biofilm at low pH values: Role of in situ microenvironments and acid tolerance. Appl. Environ. Microbiol. 72, 4283–4292. doi:10.1128/AEM.00241-06
Gilbert, E.M., Agrawal, S., Karst, S.M., Horn, H., Nielsen, P.H., Lackner, S., 2014. Low Temperature Partial Nitritation/Anammox in a Moving Bed Biofilm Reactor Treating Low Strength Wastewater. Environ. Sci. Technol. 48, 8784–8792. doi:10.1021/es501649m
![Page 196: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/196.jpg)
Chapter 11. References
173
Gilbert, E.M., Agrawal, S., Schwartz, T., Horn, H., Lackner, S., 2015. Comparing different reactor configurations for Partial Nitritation/Anammox at low temperatures. Water Res. 81, 92–100. doi:10.1016/j.watres.2015.05.022
Global Footprint Network. Natl. Footpr. Accounts. 2016 Ed. [WWW Document. Footprintnetwork.org]©
Gonzalez-Martinez, A., Rodriguez-Sanchez, A., Garcia-Ruiz, M.J., Muñoz-Palazon, B., Cortes-Lorenzo, C., Osorio, F., Vahala, R., 2016. Performance and bacterial community dynamics of a CANON bioreactor acclimated from high to low operational temperatures. Chem. Eng. J. 287, 557–567. doi:10.1016/j.cej.2015.11.081
Guerrero, J., Guisasola, A., Baeza, J.A., 2011. The nature of the carbon source rules the competition between PAO and denitrifiers in systems for simultaneous biological nitrogen and phosphorus removal. Water Res. 45, 4793–802. doi:10.1016/j.watres.2011.06.019
Hao, X., Heijnen, J.J., van Loosdrecht, M.C.M., 2002. Sensitivity analysis of a biofilm model describing a one-stage completely autotrophic nitrogen removal (CANON) process. Biotechnol. Bioeng. 77, 266–277.
Harper, W.F., Takeuchi, Y., Riya, S., Hosomi, M., Terada, A., 2015. Novel abiotic reactions increase nitrous oxide production during partial nitrification: Modeling and experiments. Chem. Eng. J. 281, 1017–1023. doi:10.1016/j.cej.2015.06.109
Hellinga, C., Schellen, a. a J.C., Mulder, J.W., Van Loosdrecht, M.C.M., Heijnen, J.J., 1998. The SHARON process: An innovative method for nitrogen removal from ammonium-rich waste water. Water Sci. Technol. 37, 135–142. doi:10.1016/S0273-1223(98)00281-9
Hendrickx, T.L.G., Kampman, C., Zeeman, G., Temmink, H., Hu, Z., Kartal, B., Buisman, C.J.N., 2014. High specific activity for anammox bacteria enriched from activated sludge at 10oC. Bioresour. Technol. 163, 214–222. doi:10.1016/j.biortech.2014.04.025
Hendrickx, T.L.G., Wang, Y., Kampman, C., Zeeman, G., Temmink, H., Buisman, C.J.N., 2012. Autotrophic nitrogen removal from low strength waste water at low temperature. Water Res. 46, 2187–93. doi:10.1016/j.watres.2012.01.037
Henze, M., Gujer, W., Mino, T., van Loosdrecht, M. C., 2000. Activated Sludge Models ASM1, ASM2, ASM2d, and ASM3. IWA Publishing, London.
Henze, M., van Loosdrecht, M.C.M., Ekama, G., Brdjanovic, D., 2008. Biological Wastewater Treatment. IWA Publ. 162–169
Hoang, V., Delatolla, R., Abujamel, T., Mottawea, W., Gadbois, a., Laflamme, E., Stintzi, a., 2014. Nitrifying Moving Bed Biofilm Reactor (MBBR) biofilm and biomass response to long term exposure to 1°C. Water Res. 49, 215–224. doi:10.1016/j.watres.2013.11.018
![Page 197: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/197.jpg)
Chapter 11. References
174
Hu, Z., Lotti, T., de Kreuk, M., Kleerebezem, R., van Loosdrecht, M., Kruit, J., Jetten, M.S.M., Kartal, B., 2013. Nitrogen removal by a nitritation-anammox bioreactor at low temperature. Appl. Environ. Microbiol. 79, 2807–12. doi:10.1128/AEM.03987-12
Hugenholtz, P., Tyson, G.W., Blackall, L.L., 2002. Design and Evaluation of 16S rRNA-Targeted Oligonucleotide Probes for Fluorescence In Situ Hybridization, in: de Muro, M.A., Rapley, R. (Eds.), Gene Probes: Principles and Protocols. Humana Press, Totowa, NJ, pp. 29–42. doi:10.1385/1-59259-238-4:029
Hulshoff Pol, L.W., De Castro Lopes, S.I., Lettinga, G., Lens, P.N.L., 2004. Anaerobic sludge granulation. Water Res. 38, 1376–1389. doi:10.1016/j.watres.2003.12.002
Hunik, J.H., 1993. Engineering aspects of nitrification with immobilized cells 1, 139.
Hunik, J.H., Bos, C.G., van den Hoogen, M.P., De Gooijer, C.D., Tramper, J., 1994. Co-immobilized Nitrosomonas europaea and Nitrobacter agilis cells: validation of a dynamic model for simultaneous substrate conversion and growth in kappa-carrageenan gel beads. Biotechnol. Bioeng. 43, 1153–63. doi:10.1002/bit.260431121
Imajo, U., Tokutomi, T., Furukawa, K., 2004. Granulation of Anammox microorganisms in up-flow reactors. Water Sci. Technol. 49, 155–164.
IPCC, 2013. The final draft Report, dated 7 June 2013, of the Working Group I contribution to the IPCC 5th Assessment Report. In: Climate Change 2013: the Physical Science Basis.
Isanta, E., Bezerra, T., Fernández, I., Suárez-ojeda, M.E., Pérez, J., Carrera, J., 2015b. Bioresource Technology Microbial community shifts on an anammox reactor after a temperature shock using 454-pyrosequencing analysis. Bioresour. Technol. 181, 207–213. doi:10.1016/j.biortech.2015.01.064
Isanta, E., Reino, C., Pérez, J., Carrera, J., 2015a. Stable partial nitritation for low strength wastewater at low temperature in an aerobic granular reactor. Water Res. doi:10.1016/j.watres.2015.04.028
Jemaat, Z., Bartrolí, A., Isanta, E., Carrera, J., Suárez-Ojeda, M.E., Pérez, J., 2013. Closed-loop control of ammonium concentration in nitritation: convenient for reactor operation but also for modeling. Bioresour. Technol. 128, 655–63. doi:10.1016/j.biortech.2012.10.045
Jetten, M., Horn, S., van Loosdrecht, M., 1997. Towards a more sustainable municipal wastewater treatment system. Water Sci. Technol. 35, 171–180. doi:10.1016/S0273-1223(97)00195-9
Jimenez, J., Miller, M., Bott, C., Murthy, S., De Clippeleir, H., Wett, B., 2015. High-rate
![Page 198: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/198.jpg)
Chapter 11. References
175
activated sludge system for carbon management - Evaluation of crucial process mechanisms and design parameters. Water Res. 1–7.
Jin, R.-C., Ma, C., Yu, J.-J., 2013. Performance of an Anammox UASB reactor at high load and low ambient temperature. Chem. Eng. J. 232, 17–25. doi:10.1016/j.cej.2013.07.059
Jin, R.C., Yang, G.F., Ma, C., Yu, J.J., Zhang, Q.Q., Xing, B.S., 2012. Influence of effluent recirculation on the performance of Anammox process. Chem. Eng. J. 200-202, 176–185. doi:10.1016/j.cej.2012.06.046
Jubany, I., Lafuente, J., Baeza, J. a., Carrera, J., 2009b. Total and stable washout of nitrite oxidizing bacteria from a nitrifying continuous activated sludge system using automatic control based on Oxygen Uptake Rate measurements. Water Res. 43, 2761–2772. doi:10.1016/j.watres.2009.03.022
Jubany, I., Lafuente, J., Carrera, J., Baeza, J.A., 2009a. Automated thresholding method (ATM) for biomass fraction determination using FISH and confocal microscopy. J. Chem. Technol. Biotechnol. 84, 1140–1145. doi:10.1002/jctb.2146
Kampschreur, M.J., Kleerebezem, R., de Vet, W.W.J.M., van Loosdrecht, M.C.M., 2011. Reduced iron induced nitric oxide and nitrous oxide emission. Water Res. 45, 5945–5952. doi:http://dx.doi.org/10.1016/j.watres.2011.08.056
Kampschreur, M.J., Temmink, H., Kleerebezem, R., Jetten, M.S.M., van Loosdrecht, M.C.M., 2009. Nitrous oxide emission during wastewater treatment. Water Res. 43, 4093–103. doi:10.1016/j.watres.2009.03.001
Kampschreur, M.J., van der Star, W.R.L., Wielders, H. a., Mulder, J.W., Jetten, M.S.M., van Loosdrecht, M.C.M., 2008. Dynamics of nitric oxide and nitrous oxide emission during full-scale reject water treatment. Water Res. 42, 812–826. doi:10.1016/j.watres.2007.08.022
Karkman, a., Mattila, K., Tamminen, M., Virta, M., 2011. Cold temperature decreases bacterial species richness in nitrogen-removing bioreactors treating inorganic mine waters. Biotechnol. Bioeng. 108, 2876–2883. doi:10.1002/bit.23267
Kartal, B., De Almeida, N.M., Maalcke, W.J., Op Den Camp, H.J.M., Jetten, M.S.M., Keltjens, J.T., 2013. How to make a living from anaerobic ammonium oxidation. FEMS Microbiol. Rev. 37, 428–61. doi:10.1111/1574-6976.12014
Kartal, B., Kuenen, J.G., van Loosdrecht, M.C.M., 2010. Sewage treatment with anammox. Science 328, 702–3. doi:10.1126/science.1185941
Kartal, B., Maalcke, W.J., de Almeida, N.M., Cirpus, I., Gloerich, J., Geerts, W., den Camp, H.J.M.O., Harhangi, H.R., Janssen-Megens, E.M., Francoijs, K.J., Stunnenberg, H.G., Keltjens, J.T., Jetten, M.S.M., Strous, M., 2011. Molecular mechanism of anaerobic
![Page 199: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/199.jpg)
Chapter 11. References
176
ammonium oxidation. Nature 479, 127–U159. doi:10.1038/Nature10453
Kartal, B., Rattray, J., van Niftrik, L.A., van de Vossenberg, J., Schmid, M.C., Webb, R.I., Schouten, S., Fuerst, J.A., Damsté, J.S., Jetten, M.S.M., Strous, M., 2007. Candidatus “Anammoxoglobus propionicus” a new propionate oxidizing species of anaerobic ammonium oxidizing bacteria. Syst. Appl. Microbiol. 30, 39–49. doi:10.1016/j.syapm.2006.03.004
Kartal, B., Van Niftrik, L., Rattray, J., Van De Vossenberg, J.L.C.M., Schmid, M.C., Sinninghe Damsté, J., Jetten, M.S.M., Strous, M., 2008. Candidatus “Brocadia fulgida”: An autofluorescent anaerobic ammonium oxidizing bacterium. FEMS Microbiol. Ecol. 63, 46–55. doi:10.1111/j.1574-6941.2007.00408.x
Kim, D.-J., Kim, S.-H., 2006. Effect of nitrite concentration on the distribution and competition of nitrite-oxidizing bacteria in nitratation reactor systems and their kinetic characteristics. Water Res. 40, 887–94. doi:10.1016/j.watres.2005.12.023
Kindaichi, T., Ito, T., Okabe, S., 2004. Ecophysiological Interaction between Nitrifying Bacteria and Heterotrophic Bacteria in Autotrophic Nitrifying Biofilms as Determined by Microautoradiography-Fluorescence In Situ Hybridization. Appl. Environ. Microbiol. 70, 1641–1650. doi:10.1128/AEM.70.3.1641-1650.2004
Knowles, G., Downing, a L., Barrett, M.J., 1965. Determination of kinetic constants for nitrifying bacteria in mixed culture, with the aid of an electronic computer. J. Gen. Microbiol. 38, 263–278. doi:10.1099/00221287-38-2-263
Lackner, S., Gilbert, E.M., Vlaeminck, S.E., Joss, A., Horn, H., van Loosdrecht, M.C.M., 2014. Full-scale partial nitritation/anammox experiences – An application survey. Water Res. 55, 292–303. doi:10.1016/j.watres.2014.02.032
Lackner, S., Terada, A., Smets, B.F., 2008. Heterotrophic activity compromises autotrophic nitrogen removal in membrane-aerated biofilms: Results of a modeling study. Water Res. 42, 1102–1112. doi:http://dx.doi.org/10.1016/j.watres.2007.08.025
Lackner, S., Welker, S., Gilbert, E.M., Horn, H., 2015. Influence of seasonal temperature fluctuations on two different partial nitritation-anammox reactors treating mainstream municipal wastewater. Water Sci. Technol. 72(8), 1358–1363. doi:10.2166/wst.2015.301
Larose, C., Berger, S., Ferrari, C., Navarro, E., Dommergue, A., Schneider, D., Vogel, T.M., 2010. Microbial sequences retrieved from environmental samples from seasonal Arctic snow and meltwater from Svalbard, Norway. Extremophiles 14, 205–212. doi:10.1007/s00792-009-0299-2
Larsen, T.A., 2015. CO2-neutral wastewater treatment plants or robust, climate-friendly wastewater management? A systems perspective. Water Res. 87, 513–521. doi:10.1016/j.watres.2015.06.006
![Page 200: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/200.jpg)
Chapter 11. References
177
Latif, M.A., Ghufran, R., Wahid, Z.A., Ahmad, A., 2011. Integrated application of upflow anaerobic sludge blanket reactor for the treatment of wastewaters. Water Res. 45, 4683–4699. doi:10.1016/j.watres.2011.05.049
Laureni, M., Falås, P., Robin, O., Wick, A., Weissbrodt, D.G., Nielsen, J.L., Ternes, T.A., Morgenroth, E., Joss, A., 2016. Mainstream partial nitritation and anammox: Long-term process stability and effluent quality at low temperatures. Water Res. 101, 628–639. doi:10.1016/j.watres.2016.05.005
Laureni, M., Weissbrodt, D.G., Szivák, I., Robin, O., Nielsen, J.L., Morgenroth, E., Joss, A., 2015. Activity and growth of anammox biomass on aerobically pre-treated municipal wastewater. Water Res. 80, 325–336. doi:http://dx.doi.org/10.1016/j.watres.2015.04.026
Li, G., Puyol, D., Carvajal-Arroyo, J.M., Sierra-Alvarez, R., Field, J.A., 2015. Inhibition of anaerobic ammonium oxidation by heavy metals. J. Chem. Technol. Biotechnol. 90, 830–837. doi:10.1002/jctb.4377
Li, X., Sun, S., Badgley, B.D., Sung, S., Zhang, H., He, Z., 2016. Nitrogen removal by granular nitritation–anammox in an upflow membrane-aerated biofilm reactor. Water Res. 94, 23–31. doi:10.1016/j.watres.2016.02.031
Liu, Y., Qin, L., Yang, S.F., 2007. Microbial Granulation Technology for Nutrient Removal from Wastewater. Nova Science Publishers.
Liu, Y., Tay, J., 2002. The essential role of hydrodynamic shear force in the formation of biofilm and granular sludge. Water Res. 36, 1653–1665.
Liu, Y., Xu, H. Lou, Yang, S.F., Tay, J.H., 2003. Mechanisms and models for anaerobic granulation in upflow anaerobic sludge blanket reactor. Water Res. 37, 661–673. doi:10.1016/S0043-1354(02)00351-2
Lotti, T., Cordola, M., Kleerebezem, R., Caffaz, S., Lubello, C., Van Loosdrecht, M.C.M., 2012. Inhibition effect of swine wastewater heavy metals and antibiotics on anammox activity. Water Sci. Technol. 66, 1519–1526. doi:10.2166/wst.2012.344
Lotti, T., Kleerebezem, R., Abelleira-Pereira, J.M., Abbas, B., van Loosdrecht, M.C.M., 2015b. Faster through training: The anammox case. Water Res. 81, 261–268. doi:10.1016/j.watres.2015.06.001
Lotti, T., Kleerebezem, R., Hu, Z., Kartal, B., de Kreuk, M.K., van Erp Taalman Kip, C., Kruit, J., Hendrickx, T.L.G., van Loosdrecht, M.C.M., 2015a. Pilot-scale evaluation of anammox-based mainstream nitrogen removal from municipal wastewater. Environ. Technol. 36, 1167–1177. doi:10.1080/09593330.2014.982722
Lotti, T., Kleerebezem, R., Hu, Z., Kartal, B., Jetten, M.S.M., Loosdrecht, M.C.M. Van, 2014a. Simultaneous partial nitritation and anammox at low temperature with granular
![Page 201: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/201.jpg)
Chapter 11. References
178
sludge. Water Res. 66, 111–121. doi:10.1016/j.watres.2014.07.047
Lotti, T., Kleerebezem, R., Lubello, C., van Loosdrecht, M.C.M., 2014c. Physiological and kinetic characterization of a suspended cell anammox culture. Water Res. 60, 1–14. doi:10.1016/j.watres.2014.04.017
Lotti, T., Kleerebezem, R., van Erp Taalman Kip, C., Hendrickx, T.L.G., Kruit, J., Hoekstra, M., van Loosdrecht, M.C.M., 2014b. Anammox growth on pretreated municipal wastewater. Environ. Sci. Technol. 48, 7874–80. doi:10.1021/es500632k
Lotti, T., Kleerebezem, R., van Loosdrecht, M.C.M., 2015c. Effect of temperature change on anammox activity. Biotechnol. Bioeng. 112, 98–103. doi:10.1002/bit.25333
Luther, A.K., Desloover, J., Fennell, D.E., Rabaey, K., 2015. Electrochemically driven extraction and recovery of ammonia from human urine. Water Res. 87, 367–377. doi:http://dx.doi.org/10.1016/j.watres.2015.09.041
Ma, B., Peng, Y., Zhang, S., Wang, J., Gan, Y., Chang, J., Wang, S., Wang, S., Zhu, G., 2013. Performance of anammox UASB reactor treating low strength wastewater under moderate and low temperatures. Bioresour. Technol. 129, 606–11. doi:10.1016/j.biortech.2012.11.025
Ma, B., Zhang, S., Zhang, L., Yi, P., Wang, J., Wang, S., Peng, Y., 2011. The feasibility of using a two-stage autotrophic nitrogen removal process to treat sewage. Bioresour. Technol. 102, 8331–4. doi:10.1016/j.biortech.2011.06.017
Malovanyy, A., Trela, J., Plaza, E., 2015. Mainstream wastewater treatment in integrated fixed film activated sludge (IFAS) reactor by partial nitritation/anammox process. Bioresour. Technol. 198, 478–487. doi:10.1016/j.biortech.2015.08.123
Mampaey, K.E., De Kreuk, M.K., van Dongen, L.G.J.M., van Loosdrecht, M.C.M., Volcke, E.I.P., 2016. Identifying N2O formation and emissions from a full-scale partial nitritation reactor. Water Res. 88, 575–585. doi:10.1016/j.watres.2015.10.047
Manz, W., Amann, R., Ludwig, W., Wagner, M., Schleifer, K.-H., 1992. Phylogenetic Oligodeoxynucleotide Probes for the Major Subclasses of Proteobacteria: Problems and Solutions. Syst. Appl. Microbiol. 15, 593–600. doi:10.1016/S0723-2020(11)80121-9
Martín-Hernández, M., Carrera, J., Pérez, J., Suárez-Ojeda, M.E., 2009. Enrichment of a K-strategist microbial population able to biodegrade p-nitrophenol in a sequencing batch reactor. Water Res. 43, 3871–3883. doi:10.1016/j.watres.2009.06.001
Mobarry, B., Wagner, M., Urbain, V., Rittmann, B., Stahl, D., 1996. Phylogenetic Probes for Analyzing Abundance and Spatial Organization of Nitrifying Bacteria. Appl. Envir. Microbiol. 62, 2156–2162.
![Page 202: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/202.jpg)
Chapter 11. References
179
Morales, N., Val del Río, Á., Vázquez-Padín, J.R., Méndez, R., Mosquera-Corral, A., Campos, J.L., 2015. Integration of the Anammox process to the rejection water and main stream lines of WWTPs. Chemosphere 140, 99–105. doi:10.1016/j.chemosphere.2015.03.058
Mulder, A, Graaf, A, Robertson, L. A, Kuenen, J.G., 1995. Anaerobic ammonium oxidation discovered in a denitrifying fluidized bed reactor. Fems Microbiol. Ecol. doi:10.1111/j.1574-6941.1995.tb00281.x
Nogueira, R., Elenter, D., Brito, a, Melo, L.F., Wagner, M., Morgenroth, E., 2005. Evaluating heterotrophic growth in a nitrifying biofilm reactor using fluorescence in situ hybridization and mathematical modeling. Water Sci. Technol. 52, 135–141.
Okabe, S., Kindaichi, T., Ito, T., 2005. Fate of C-Labeled Microbial Products Derived from Nitrifying Bacteria in Autotrophic Nitrifying Biofilms 3987–3994. doi:10.1128/AEM.71.7.3987
Okabe, S., Oshiki, M., Takahashi, Y., Satoh, H., 2011. N2O emission from a partial nitrification-anammox process and identification of a key biological process of N2O emission from anammox granules. Water Res. 45, 6461–6470. doi:10.1016/j.watres.2011.09.040
Park, J., Byun, I., Park, S., Park, T., 2008. Nitrifying bacterial communities and its activities in aerobic biofilm reactors under different temperature conditions. Korean J. Chem. Eng. 25, 1448–1455. doi:10.1007/s11814-008-0238-4
Park, H., Rosenthal, A., Jezek, R., Ramalingam, K., Fillos, J., Chandran, K., 2010. Impact of inocula and growth mode on the molecular microbial ecology of anaerobic ammonia oxidation (anammox) bioreactor communities. Water Res. 44, 5005–5013. doi:10.1016/j.watres.2010.07.022
Pérez, J., Isanta, E., Carrera, J., 2015. Would a two-stage N-removal be a suitable technology to implement at full scale the use of anammox for sewage treatment? Water Sci. Technol. 72, 858. doi:10.2166/wst.2015.281
Pérez, J., Lotti, T., Kleerebezem, R., Picioreanu, C., van Loosdrecht, M.C.M., 2014. Outcompeting nitrite-oxidizing bacteria in single-stage nitrogen removal in sewage treatment plants: a model-based study. Water Res. 66, 208–18. doi:10.1016/j.watres.2014.08.028
Pijuan, M., Torà, J., Rodríguez-Caballero, A., César, E., Carrera, J., Pérez, J., 2014. Effect of process parameters and operational mode on nitrous oxide emissions from a nitritation reactor treating reject wastewater. Water Res. 49, 23–33. doi:10.1016/j.watres.2013.11.009
![Page 203: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/203.jpg)
Chapter 11. References
180
Prehn, J., Waul, C.K., Pedersen, L.-F., Arvin, E., 2012. Impact of water boundary layer diffusion on the nitrification rate of submerged biofilter elements from a recirculating aquaculture system. Water Res. 46, 3516–24. doi:10.1016/j.watres.2012.03.053
Ramos, C., Suárez-Ojeda, M.E., Carrera, J., 2016. Denitritation in an anoxic granular reactor using phenol as sole organic carbon source. Chem. Eng. J. 288, 289–297. doi:http://dx.doi.org/10.1016/j.cej.2015.11.099
Ravishankara, A.R., Daniel, J.S., Portmann, R.W., 2009. Nitrous Oxide (N2O): The Dominant Ozone-Depleting Substance Emitted in the 21st Century. Science. 326, 123 LP – 125.
Rathnayake, R.M.L.D., Song, Y., Tumendelger, a., Oshiki, M., Ishii, S., Satoh, H., Toyoda, S., Yoshida, N., Okabe, S., 2013. Source identification of nitrous oxide on autotrophic partial nitrification in a granular sludge reactor. Water Res. 47, 7078–7086. doi:10.1016/j.watres.2013.07.055
Reino, C., Suárez-Ojeda, M.E., Pérez, J., Carrera, J., 2016. Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10 °C. Water Res. 101, 147–156. doi:10.1016/j.watres.2016.05.059
Regmi, P., Miller, M.W., Holgate, B., Bunce, R., Park, H., Chandran, K., Wett, B., Murthy, S., Bott, C.B., 2014. Control of aeration, aerobic SRT and COD input for mainstream nitritation/denitritation. Water Res. 57, 162–71. doi:10.1016/j.watres.2014.03.035
Rosenwinkel, K.H., Cornelius, A., 2005. Deammonification in the moving-bed process for the treatment of wastewater with high ammonia content. Chem. Eng. Technol. 28, 49–52.
Rysgaard, S., Glud, R.N., Risgaard-Petersen, N., Dalsgaard, T., 2004. Denitrification and anammox activity in Arctic marine sediments. Limnol. Oceanogr. 49, 1493–1502. doi:10.4319/lo.2004.49.5.1493
Sabba, F., Picioreanu, C., Pérez, J., Nerenberg, R., 2015. Hydroxylamine Diffusion Can Enhance N2O Emissions in Nitrifying Biofilms: A Modeling Study. Environ. Sci. Technol. 49, 1486–1494. doi:10.1021/es5046919
Sánchez Guillén, J. a., Lopez Vazquez, C.M., de Oliveira Cruz, L.M., Brdjanovic, D., van Lier, J.B., 2016. Long-term performance of the Anammox process under low nitrogen sludge loading rate and moderate to low temperature. Biochem. Eng. J. 110, 95–106. doi:10.1016/j.bej.2016.02.004
Sander, R., 2015. Compilation of Henry’s law constants (version 4.0) for water as solvent. Atmos. Chem. Phys. 15, 4399–4981. doi:10.5194/acp-15-4399-2015
Schmid, M., Schmitz-Esser, S., Jetten, M., Wagner, M., 2001. 16S-23S rDNA intergenic spacer and 23S rDNA of anaerobic ammonium-oxidizing bacteria: implications for
![Page 204: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/204.jpg)
Chapter 11. References
181
phylogeny and in situ detection. Environ. Microbiol. 3, 450–459. doi:10.1046/j.1462-2920.2001.00211.x
Schreiber, F., Loeffler, B., Polerecky, L., Kuypers, M.M., de Beer, D., 2009. Mechanisms of transient nitric oxide and nitrous oxide production in a complex biofilm. ISME J. 3, 1301–1313. doi:10.1038/ismej.2009.55
Seghezzo, L., Zeeman, G., Liel, J.B. Van, Hamelers, H.V.M., Lettinga, G., 1998. A REVIEW : The anaerobic treatment of sewage in UASB and EGSB reactors 65, 175–190.
Siegrist, H., Salzgeber, D., Eugster, J., Joss, A., 2008. Anammox brings WWTP closer to energy autarky due to increased biogas production and reduced aeration energy for N-removal. Water Sci. Technol. 57, 383–388.
Sin, G., Kaelin, D., Kampschreur, M.J., Takács, I., Wett, B., Gernaey, K. V, Rieger, L., Siegrist, H., van Loosdrecht, M.C.M., 2008. Modelling nitrite in wastewater treatment systems: a discussion of different modelling concepts. Water Sci. Technol. 58, 1155–1171.
Singh, P., Kapse, N., Arora, P., Singh, S.M., Dhakephalkar, P.K., 2015. Draft genome of Cryobacterium sp. MLB-32, an obligate psychrophile from glacier cryoconite holes of high Arctic. Mar. Genomics 21, 25–26. doi:10.1016/j.margen.2015.01.006
Soler-Jofra, A., Stevens, B., Hoekstra, M., Picioreanu, C., Sorokin, D., van Loosdrecht, M.C.M., Pérez, J., 2016. Importance of abiotic hydroxylamine conversion on nitrous oxide emissions during nitritation of reject water. Chem. Eng. J. 287, 720–726. doi:10.1016/j.cej.2015.11.073
Sözen, S., Orhon, D., San, H.A., 1996. A new approach for the evaluation of the maximum specific growth rate in nitrification. Water Res. 30, 1661–1669. doi:10.1016/0043-1354(96)00031-0
Stoddard S.F., Smith B.J., Hein R., Roller B.R.K., Schmidt T.M., 2015. rrnDB: improved tools for interpreting rRNA gene abundance in bacteria and archaea and a new foundation for future development, Nucleic Acids Res. 43, 593–D598. doi:10.1093/nar/gku1201 .
Strous, M., Heijnen, J.J., Kuenen, G.J., Jetten, M.M.S., 1998. The sequencing batch reactor as a powerful tool for the study of slowly growing anaerobic ammonium-oxidizing microorganisms. Appl. Microbiol. Biotechnol. 50, 589–596. doi:10.1007/s002530051340
Strous, M., Kuenen, J.G., Jetten, M.S.M., 1999. Key Physiology of Anaerobic Ammonium Oxidation Key Physiology of Anaerobic Ammonium Oxidation. Appl. Environ. Microbiol. 65, 0–3. doi:papers2://publication/uuid/E9A1573A-6D62-420E-94D0-
![Page 205: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/205.jpg)
Chapter 11. References
182
CA7C84D0FEB9
Suzuki, I., Dular, U., Kwok, S., 1974. Ammonia or Ammonium Ion as Substrate for Oxidation by Nitrosomonas-Europaea Cells and Extracts. J. Bacteriol. 120, 556–558.
Tamimi, A., Rinker, E.B., Sandall, O.C., 1994. Diffusion Coefficients for Hydrogen Sulfide, Carbon Dioxide, and Nitrous Oxide in Water over the Temperature Range 293-368 K. J. Chem. Eng. Data 39, 330–332. doi:10.1021/je00014a031
Tang, C.-J., Zheng, P., Wang, C.-H., Mahmood, Q., Zhang, J.-Q., Chen, X.-G., Zhang, L., Chen, J.-W., 2011. Performance of high-loaded ANAMMOX UASB reactors containing granular sludge. Water Res. 45, 135–44. doi:10.1016/j.watres.2010.08.018
Terada, A., Sugawara, S., Yamamoto, T., Zhou, S., Koba, K., Hosomi, M., 2013. Physiological characteristics of predominant ammonia-oxidizing bacteria enriched from bioreactors with different influent supply regimes. Biochem. Eng. J. 79, 153–161. doi:10.1016/j.bej.2013.07.012
Udert, K.M., Wächter, M., 2012. Complete nutrient recovery from source-separated urine by nitrification and distillation. Water Res. 46, 453–464. doi:10.1016/j.watres.2011.11.020
Vadivelu, V.M., Keller, J., Yuan, Z., 2006. Stoichiometric and kinetic characterisation of Nitrosomonas sp. in mixed culture by decoupling the growth and energy generation processes. J. Biotechnol. 126, 342–56. doi:10.1016/j.jbiotec.2006.04.017
van de Graaf, A.A.V., Debruijn, P., Robertson, L.A., Jetten, M.S.M., Kuenen, J.G., 1996. Autotrophic growth of anaerobic ammonium-oxidizing micro- organisms in a fluidized bed reactor. Microbiology-Uk 142, 2187–2196. doi:10.1099/13500872-142-8-2187
van der Star, W.R.L., Abma, W.R., Blommers, D., Mulder, J.-W., Tokutomi, T., Strous, M., Picioreanu, C., van Loosdrecht, M.C.M., 2007. Startup of reactors for anoxic ammonium oxidation: experiences from the first full-scale anammox reactor in Rotterdam. Water Res. 41, 4149–63. doi:10.1016/j.watres.2007.03.044
van Haandel, A.C., van der Lubbe, J.G.M., 2012. Handbook of Biological Wastewater Treatment: Design and Optimisation of Activated Sludge Systems. IWA Pub.
van Hulle, S.W.H., Vandeweyer, H.J.P., Meesschaert, B.D., Vanrolleghem, P.A., Dejans, P., Dumoulin, A., 2010. Engineering aspects and practical application of autotrophic nitrogen removal from nitrogen rich streams. Chem. Eng. J. 162, 1–20. doi:10.1016/j.cej.2010.05.037
van Loosdrecht, M.C.M., Brdjanovic, D., 2014. Anticipating the next century of wastewater treatment. Science. 344, 1452–1453. doi:10.1126/science.1255183
![Page 206: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/206.jpg)
Chapter 11. References
183
van Trappen, S., Mergaert, J., Swings, J., 2003. Flavobacterium gelidilacus sp. nov., isolated from microbial mats in Antarctic lakes. Int. J. Syst. Evol. Microbiol. 53, 1241–1245. doi:10.1099/ijs.0.02583-0
Vannecke, T.P.W., Volcke, E.I.P., 2015. Modelling microbial competition in nitrifying biofilm reactors. Biotechnol. Bioeng., 112, 2550-61. doi:10.1002/bit.25680
Vázquez-Padín, J.R., Fernández, I., Morales, N., Campos, J.L., Mosquera-Corral, A., Méndez, R., 2011. Autotrophic nitrogen removal at low temperature. Water Sci. Technol. 63, 1282–1288.
Verstraete, W., Siegfried, E.V., 2011. ZeroWasteWater: short-cycling of wastewater resources for sustainable cities of the future. Int. J. Sustain. Dev. World Ecol. 253–264.
Wagner, M., Loy, A., Nogueira, R., Purkhold, U., Lee, N., Daims, H., 2002. Microbial community composition and function in wastewater treatment plants. Antonie Van Leeuwenhoek 81, 665–680. doi:10.1023/a:1020586312170
Wagner, M., Rath, G., Koops, H.P., Flood, J., Amann, R., 1996. In situ analysis of nitrifying bacteria in sewage treatment plants. Water Sci. Technol. 34 (1-2), 237-244
Wang, F., Liu, Y., Ma, Y., Wu, X., Yang, H., 2012. Characterization of nitrification and microbial community in a shallow moss constructed wetland at cold temperatures. Ecol. Eng. 42, 124–129. doi:10.1016/j.ecoleng.2012.01.006
Wang, D., Wang, Q., Laloo, A., Xu, Y., Bond, P.L., Yuan, Z., 2016a. Achieving Stable Nitritation for Mainstream Deammonification by Combining Free Nitrous Acid-Based Sludge Treatment and Oxygen Limitation. Sci. Rep. 6, 25547. doi:10.1038/srep25547
Wang, D., Wang, Q., Laloo, A.E., Yuan, Z., 2016b. Reducing N2O Emission from a Domestic-Strength Nitrifying Culture by Free Nitrous Acid-Based Sludge Treatment. Environ. Sci. Technol. acs.est.6b00660. doi:10.1021/acs.est.6b00660
Wanner, O., Eberl, H., Morgenroth, E., Noguera, D., Picioreanu, C., Rittmann, B., van Loosdrecht, M., 2006. Mathematical modeling of biofilms. Sci. Tech. Rep. No. 18. IWA Publ. London, UK.
Weiss, R.F., Price, B.A., 1980. Nitrous oxide solubility in water and seawater. Mar. Chem. 8, 347–359. doi:10.1016/0304-4203(80)90024-9
Wett, B., 2007. Development and implementation of a robust deammonification process. Water Sci. Technol. 56, 81–88.
Wett, B., Omari, a., Podmirseg, S.M., Han, M., Akintayo, O., Gómez Brandón, M., Murthy, S., Bott, C., Hell, M., Takács, I., Nyhuis, G., O’Shaughnessy, M., 2013. Going for mainstream deammonification from bench to full scale for maximized resource
![Page 207: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/207.jpg)
Chapter 11. References
184
efficiency. Water Sci. Technol. 68, 283–289. doi:10.2166/wst.2013.150
Winkler, M.K.H., Kleerebezem, R., Kuenen, J.G., Yang, J., Loosdrecht, M.C.M. Van, 2011. Segregation of biomass in cyclic anaerobic / aerobic granular sludge allows the enrichment of anaerobic ammonium oxidizing bacteria at low temperatures. Environ. Sci. Technol. 7330–7337.
Wittebolle, L., Boon, N., Vanparys, B., Heylen, K., De Vos, P., Verstraete, W., 2005. Failure of the ammonia oxidation process in two pharmaceutical wastewater treatment plants is linked to shifts in the bacterial communities. J. Appl. Microbiol. 99, 997–1006. doi:10.1111/j.1365-2672.2005.02731.x
Wunderlin, P., Mohn, J., Joss, A., Emmenegger, L., Siegrist, H., 2012. Mechanisms of N2O production in biological wastewater treatment under nitrifying and denitrifying conditions. Water Res. 46, 1027–37. doi:10.1016/j.watres.2011.11.080
Xing, B.-S., Guo, Q., Zhang, Z.-Z., Zhang, J., Wang, H.-Z., Jin, R.-C., 2014. Optimization of process performance in a granule-based anaerobic ammonium oxidation (anammox) upflow anaerobic sludge blanket (UASB) reactor. Bioresour. Technol. 170, 404–12. doi:10.1016/j.biortech.2014.08.026
Yamagishi, T., Takeuchi, M., Wakiya, Y., Waki, M., 2013. Distribution and characterization of anammox in a swine wastewater activated sludge facility. Water Sci. Technol. 67, 2330–2336.
Yang, G.-F., Ni, W.-M., Wu, K., Wang, H., Yang, B.-E., Jia, X.-Y., Jin, R.-C., 2013. The effect of Cu(II) stress on the activity, performance and recovery on the Anaerobic Ammonium-Oxidizing (Anammox) process. Chem. Eng. J. 226, 39–45. doi:http://dx.doi.org/10.1016/j.cej.2013.04.019
Zessner, M., Lampert, C., Kroiss, H., Lindtner, S., 2010. Cost comparison of wastewater in Danubian countries. Water Sci. Technol. 62, 223–230.
Zhang, D.C., Wang, H.X., Cui, H.L., Yang, Y., Liu, H.C., Dong, X.Z., Zhou, P.J., 2007. Cryobacterium psychrotolerans sp. nov., a novel psychrotolerant bacterium isolated from the China No. 1 glacier. Int. J. Syst. Evol. Microbiol. 57, 866–869. doi:10.1099/ijs.0.64750-0
Zhang J., Kobert K., Flouri T., Stamatakis A., 2014. PEAR: a fast and accurate Illumina Paired-End reAd mergeR, Bioinformatics 30, 614-620.
Zhang, Z.Z., Cheng, Y.F., Zhou, Y.H., Buayi, X., Jin, R.C., 2016a. Roles of EDTA washing and Ca2+ regulation on the restoration of anammox granules inhibited by copper(II). J. Hazard. Mater. 301, 92–99. doi:10.1016/j.jhazmat.2015.08.036
![Page 208: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/208.jpg)
Chapter 11. References
185
Zhang, Z.Z., Deng, R., Cheng, Y.F., Zhou, Y.H., Buayi, X., Zhang, X., Wang, H.Z., Jin, R.C., 2015. Behavior and fate of copper ions in an anammox granular sludge reactor and strategies for remediation. J. Hazard. Mater. 300, 838–846. doi:10.1016/j.jhazmat.2015.08.024
Zhang, Z.Z., Zhang, Q.Q., Xu, J.J., Deng, R., Ji, Z.Q., Wu, Y.H., Jin, R.C., 2016b. Evaluation of the inhibitory effects of heavy metals on anammox activity: A batch test study. Bioresour. Technol. 200, 208–216. doi:10.1016/j.biortech.2015.10.035
![Page 209: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/209.jpg)
Chapter 11. References
186
![Page 210: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/210.jpg)
ANNEX I COMPLETE PYROSEQUENCING ANALYSIS
RESULTS
Pyrosequencing technique was used to evaluate the diversity and relative
abundance of the different microorganisms present in the granular sludge of the
reactors of this thesis.
Hence, this annex compiles the results obtained from the pyrosequencing
analysis performed in samples of the lab-scale airlift reactor during the operation
described in Chapter 5 and the lab-scale upflow anammox sludge bed reactor
during the operation described in Chapter 9.
Furthermore, the indices of biological diversity were calculated for the obtained
libraries indicating that a good coverage of diversity was reached.
![Page 211: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/211.jpg)
Annex I. Complete Pyrosequencing Analysis Results.
188
I. PYROSEQUENCING ANALYSIS RESULTS FOR THE SAMPLES ANALYSED DURING THE CHAPTER 5: Kinetic and microbiological characterization of aerobic granules performing partial nitritation of a low-strength wastewater at 10ºC.
Figure AI.1.1. Rarefaction curves for the library of day 98. OTUs were
defined at 3%, 5% and 10% distances, respectively.
Figure AI.1.2. Rarefaction curves for the library of day 233. OTUs were defined
at 3%, 5% and 10% distances, respectively.
Number of sequences0 5000 10000 15000 20000
Num
ber o
f OTU
s
0
200
400
600
800
10003% 5% 10%
Number of sequences0 100 200 300 400 500
Num
ber o
f OTU
s
0
200
400
600
800
1000
3% 5% 10%
![Page 212: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/212.jpg)
Annex I. Complete Pyrosequencing Analysis Results.
189
Table AI.1.1. Indices of richness Chao1, diversity Shannon (H’) and E of Eubacteria at 97, 95
and 90% of similitude for libraries d-98 and d-233 at which biomass samples were obtained.
Library Chao1 Shannon (H') E
97% Similitude
d-98 1434 3.61 0.5358
d-233 267 3.20 0.7012
95% Similitude
d-98 557 3.35 0.5513
d-233 147 3.02 0.7040
90% Similitude
d-98 220 3.11 0.6013
d-233 70 2.71 0.7038
![Page 213: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/213.jpg)
190
Table. AI.1.2. Pyrosequencing analysis results for the sample of day 98. Relative abundance was calculated considering only the
microorganisms which the number of 16s copies was higher than 0.5% of the total copies.
Kingdom Phylum Class Order Family Genus Species Relative Abundance (%)
Bacteria Proteobacteria Betaproteobacteria Nitrosomonadales Nitrosomonadaceae Nitrosomonas Nitrosomonas sp 40.8 Bacteria Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas sp 7.9 Bacteria Proteobacteria Betaproteobacteria Nitrosomonadales Nitrosomonadaceae Nitrosospira Nitrosospira sp 7.2 Bacteria Actinobacteria Actinobacteria (class) Actinomycetales Microbacteriaceae Cryobacterium Cryobacterium sp 7.1 Bacteria Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingopyxis Sphingopyxis macrogoltabida 5.4 Bacteria Bacteroidetes Flavobacteriia Flavobacteriales Flavobacteriaceae Flavobacterium Flavobacterium sp 4.7 Bacteria Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae Comamonas Comamonas nitrativorans 4.5 Bacteria Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae Dokdonella Dokdonella sp 4.4 Bacteria Bacteroidetes Cytophagia Cytophagales Cytophagaceae Flexibacter Flexibacter sp 4.0 No Hit No Hit No Hit No Hit No Hit No Hit No Hit 3.3 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Phyllobacteriaceae Mesorhizobium Mesorhizobium sp 2.1 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Bradyrhizobiaceae Nitrobacter Nitrobacter sp 1.5 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Brucellaceae Mycoplana Mycoplana sp 1.3 Bacteria Proteobacteria Alphaproteobacteria Rhodobacterales Rhodobacteraceae Rhodobacter Rhodobacter sp 0.9 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Hyphomicrobiaceae Devosia Devosia insulae 0.8 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Phyllobacteriaceae Nitratireductor Nitratireductor sp 0.7 Bacteria Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae Frateuria Frateuria aurantia 0.7 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Rhizobiaceae Shinella Shinella sp 0.6 Bacteria Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas wittichii 0.6 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Bradyrhizobiaceae Afipia Afipia sp 0.6 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Rhizobiaceae Sinorhizobium Sinorhizobium sp 0.5 Bacteria Bacteroidetes Sphingobacteriia Sphingobacteriales Chitinophagaceae Chitinophaga Chitinophaga sp 0.3
![Page 214: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/214.jpg)
191
Table. AI.1.3. Pyrosequencing Analysis Results for the sample of day 233 after the bioinformatics treatment. Relative abundance was calculated
considering only the microorganisms which the number of 16s copies was higher than 0.5% of the total copies.
Kingdom Phylum Class Order Family Genus Species Relative Abundance (%)
Bacteria Proteobacteria Betaproteobacteria Nitrosomonadales Nitrosomonadaceae Nitrosomonas Nitrosomonas europaea 65.2 Bacteria Bacteroidetes Cytophagia Cytophagales Unclassified Unclassified Unclassified 14.6 Bacteria Bacteroidetes Unclassified Unclassified Unclassified Unclassified Unclassified 7.8 Bacteria Actinobacteria Actinobacteria Actinomycetales Microbacteriaceae Cryobacterium Cryobacterium mesophilum 2.1 Bacteria Unclassified Unclassified Unclassified Unclassified Unclassified Unclassified 1.8 Bacteria Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas sp 1.6 Bacteria Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae Comamonas Comamonas nitrativorans 1.5 Bacteria Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae Acidovorax Acidovorax sp 1.1 Bacteria Bacteroidetes Flavobacteriia Flavobacteriales Flavobacteriaceae Flavobacterium Flavobacterium sp 0.9 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Phyllobacteriaceae Mesorhizobium Mesorhizobium sp 0.8 Bacteria Proteobacteria Gammaproteobacteria Xanthomonadales Unclassified Unclassified Unclassified 0.8 Bacteria Proteobacteria Alphaproteobacteria Caulobacterales Caulobacteraceae Brevundimonas Brevundimonas sp 0.7 Bacteria Chloroflexi Anaerolineae Anaerolineales Unclassified Unclassified Unclassified 0.6 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Hyphomicrobiaceae Devosia Devosia sp 0.6
![Page 215: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/215.jpg)
Annex I. Complete Pyrosequencing Analysis Results.
192
II. PYROSEQUENCING ANALYSIS RESULTS FOR THE SAMPLES ANALYSED DURING THE CHAPTER 9: Stable long-term operation of an anammox UASB reactor at mainstream conditions
Figure AI.2.1. Rarefaction curves for the library of day 240. OTUs were defined at 3%, 5%
and 10% distances, respectively.
Figure AI.2.2. Rarefaction curves for the library of day 347. OTUs were defined at 3%, 5%
and 10% distances, respectively.
Number of sequences0 10000 20000 30000 40000 50000
Num
ber o
f OTU
s
0
1000
2000
3000
4000
3%5%10%
Number of sequences0 10000 20000 30000
Num
ber o
f OTU
s
0
1000
2000
3000
4000
3%5%10%
![Page 216: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/216.jpg)
Annex I. Complete Pyrosequencing Analysis Results
193
Figure AI.2.3. Rarefaction curves for the library of day 347. OTUs were defined at 3%, 5%
and 10% distances, respectively.
Table AI.2.1. Indices of richness Chao1, diversity Shannon (H’) and E of Eubacteria at 97, 95
and 90% of similitude for libraries d-240, d-374 and d-448 at which biomass samples were
obtained.
Library Chao1 Shannon (H') E
97% Similitude
d-240 9590 4.95 0.5897
d-374 3864 4.59 0.6022
d-448 6100 5.47 0.6903
95% Similitude
d-240 4944 4.22 0.5295
d-374 2099 4.18 0.5784
d-448 3362 5.08 0.6710
90% Similitude
d-240 1204 3.22 0.4636
d-374 801 3.75 0.5772
d-448 1034 4.39 0.6526
Number of sequences0 10000 20000
Num
ber o
f OTU
s
0
1000
2000
3000
4000
3%5%10%
![Page 217: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/217.jpg)
Table. AI.2.2. Pyrosequencing Analysis Results for the sample of day 240 after the bioinformatics treatment. Relative abundance was calculated
considering only the microorganisms which the number of 16s copies was higher than 0.5% of the total copies.
Kingdom Phylum Class Order Family Genus Species Relative
Abundance (%)
Bacteria Planctomycetes Planctomycetia Candidatus Brocadiales
Candidatus Brocadiaceae
Candidatus Brocadia
Candidatus Brocadia sp 54.6
Bacteria Planctomycetes Unclassified Unclassified Unclassified Unclassified Unclassified 15.1
Bacteria Proteobacteria Betaproteobacteria Rhodocyclales Rhodocyclaceae Denitratisoma Denistratisoma oestradiolicum 13.6
Bacteria Planctomycetes Planctomycetia Candidatus Brocadiales
Candidatus Brocadiaceae
Candidatus Brocadia Unclassified 5.8
Bacteria Unclassified Unclassified Unclassified Unclassified Unclassified Unclassified 4.3 Bacteria Verrucomicrobia Optitutae Optitutales Unclassified Unclassified Unclassified 3.9 Bacteria Bacteroidetes Cytophagia Cytophagales Unclassified Unclassified Unclassified 1.6 Bacteria Proteobacteria Betaproteobacteria Burkholderiales Unclassified Unclassified Unclassified 0.6 Bacteria Proteobacteria Betaproteobacteria Unclassified Unclassified Unclassified Unclassified 0.6
![Page 218: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/218.jpg)
Table. AI.2.3. Pyrosequencing Analysis Results for the sample of day 347 after the bioinformatics treatment. Relative abundance was calculated
considering only the microorganisms which the number of 16s copies was higher than 0.5% of the total copies.
Kingdom Phylum Class Order Family Genus Species Relative
Abundance (%)
Bacteria Unclassified Unclassified Unclassified Unclassified Unclassified Unclassified 37.3
Bacteria Proteobacteria Betaproteobacteria Rhodocyclales Rhodocyclaceae Denitratisoma Denistratisoma oestradiolicum 17.7
Bacteria Planctomycetes Planctomycetia Candidatus Brocadiales
Candidatus Brocadiaceae
Candidatus Brocadia
Candidatus Brocadia sp 13.0
Bacteria Planctomycetes Planctomycetia Unclassified Unclassified Unclassified Unclassified 7.3 Bacteria Proteobacteria Betaproteobacteria Burkholderiales Unclassified Unclassified Unclassified 5.7
Bacteria Planctomycetes Planctomycetia Candidatus Brocadiales
Candidatus Brocadiaceae
Candidatus Kuenenia
Candidatus Kuenenia sp 3.3
Bacteria Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae Massilia Naxibacter sp 1.6 Bacteria Proteobacteria Betaproteobacteria Rhodocyclales Unclassified Unclassified Unclassified 1.5 Bacteria Ignavibacteriae Ignavibacteria Ignavibacteriales Ignavibacteriaceae Ignavibacterium Unclassified 1.3 Bacteria Firmicutes Bacilli Bacillales Planococcaceae Planococcus Planococcus sp 1.1 No hit No hit No hit No hit No hit No hit No hit 1.1 Bacteria Firmicutes Bacilli Bacillales Unclassified Unclassified Unclassified 0.95 Bacteria Proteobacteria Deltaproteobacteria Desulfuromonadales Geobacteraceae Unclassified Unclassified 0.93 Bacteria Bacteroidetes Cytophagia Cytophagales Unclassified Unclassified Unclassified 0.84 Bacteria Chloroflexi Anaerolineae Anaerolineales Unclassified Unclassified Unclassified 0.82 Bacteria Verrucomicrobia Opitutae Opitutales Unclassified Unclassified Unclassified 0.82 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Hyphomicrobiaceae Devosia Devosia sp 0.76 Bacteria Proteobacteria Alphaproteobacteria Rhodobacterales Rhodobacteraceae Paracoccus Paracoccus sp 0.75 Bacteria Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae Stenotrophomonas Stenotrophomonas sp 0.72 Bacteria Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas Pseudomonas sp 0.66 Bacteria Proteobacteria Deltaproteobacteria Unclassified Unclassified Unclassified Unclassified 0.64 Bacteria Proteobacteria Alphaproteobacteria Caulobacterales Caulobacteraceae Brevundimonas Brevundimonas sp 0.59 Bacteria Acidobacteria Acidobacteriia Acidobacteriales Unclassified Unclassified Unclassified 0.58
![Page 219: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/219.jpg)
Table. AI.2.4. Pyrosequencing Analysis Results for the sample of day 448 after the bioinformatics treatment. Relative abundance was calculated
considering only the microorganisms which the number of 16s copies was higher than 0.5% of the total copies.
Kingdom Phylum Class Order Family Genus Species Relative
Abundance (%)
Bacteria Unclassified Unclassified Unclassified Unclassified Unclassified Unclassified 40.2
Bacteria Proteobacteria Betaproteobacteria Rhodocyclales Rhodocyclaceae Denitratisoma Denistratisoma oestradiolicum 20.1
Bacteria Proteobacteria Betaproteobacteria Burkholderiales Unclassified Unclassified Unclassified 6.5 Bacteria Ignavibacteriae Ignavibacteria Ignavibacteriales Ignavibacteriaceae Ignavibacterium Unclassified 6.1
Bacteria Planctomycetes Planctomycetia Candidatus Brocadiales
Candidatus Brocadiaceae
Candidatus Brocadia
Candidatus Brocadia sp 5.0
Bacteria Proteobacteria Gammaproteobacteria Xanthomonadales Unclassified Unclassified Unclassified 3.4 Bacteria Acidobacteria Acidobacteriia Acidobacteriales Unclassified Unclassified Unclassified 2.8 Bacteria Proteobacteria Alphaproteobacteria Rhodospirillales Unclassified Unclassified Unclassified 2.2 No hit No hit No hit No hit No hit No hit No hit 1.5 Bacteria Proteobacteria Betaproteobacteria Rhodocyclales Unclassified Unclassified Unclassified 1.4 Bacteria Verrucomicrobia Opitutae Opitutales Unclassified Unclassified Unclassified 1.2 Bacteria Proteobacteria Betaproteobacteria Burkholderiales Burkholderiaceae Unclassified Unclassified 1.1 Bacteria Proteobacteria Alphaproteobacteria Rhizobiales Phyllobacteriaceae Mesorhizobium Mesorhizobium sp 1.1 Bacteria Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae Thermomonas Thermononas sp 1.0 Bacteria Chloroflexi Anaerolineae Anaerolineales Unclassified Unclassified Unclassified 1.0 Bacteria Bacteroidetes Cytophagia Cytophagales Unclassified Unclassified Unclassified 0.9
Bacteria Acidobacteria Solibacteres Solibacterales Solibacteraceae Candidatus Solibacter
Candidatus Solibacter sp 0.8
Bacteria Proteobacteria Betaproteobacteria Rhodocyclales Unclassified Unclassified Unclassified 0.8 Bacteria Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae Acidovorax Acidovorax sp 0.7 Bacteria Bacteroidetes Flavobateriia Flavobacteriales Flavobacteriaceae Flavobacterium Flavobacterium sp 0.7 Bacteria Planctomycetes Planctomycetia Unclassified Unclassified Unclassified Unclassified 0.6 Bacteriaa Gemmatimonadetes Gemmatimonadetes Gemmatimonadales Gemmatimonadaceae Gemmatimonas Gemmatimonas sp 0.6
![Page 220: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/220.jpg)
ANNEX II INORGANIC ELEMENTS ANALYSIS
This annex compiles the detailed results obtained from the semi-quantitative
analysis performed to the sludge samples of the lab-scale upflow anammox
sludge bed reactor during the operation described in Chapter 9. A general
screening of the most common inorganic elements present in the sludge treating a
real urban wastewater was performed.
![Page 221: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/221.jpg)
Annex II. Inorganic elements analysis
Table AII.1.1. Inorganic elements detected in samples of granular biomass from inoculum (day
0, synthetic influent) and from day 423 (real urban wastewater). The results are presented in
micrograms of metal per gram of lyophilised biomass.
Element Inoculum Day 423 Na 21 14 Mg 3 2 Al < 0,25 0.7 P 20 24 S 13 < 10 K 3 1
Ca 31 37 Mn 0.2 0.2 Fe 7 11 Li < 5 < 5 B < 50 60 V < 5 < 5
Cr 221 73 Co 5 45 Ni 68 114 Cu 73 350 Zn 181 1882 As < 5 < 5 Se 31 20 Br < 5 < 5 Rb < 5 < 5 Sr 52 455
Mo 11 < 5 Ru < 5 < 5 Rh < 5 < 5 Pd < 5 < 5 Ag < 5 < 5 Cd < 5 < 5 Sn < 5 32 Sb < 5 < 5 Te < 5 < 5
I < 5 < 5 Ba 28 266 La < 5 < 5 Ce < 5 < 5 Pr < 5 < 5
![Page 222: ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda ......anammox activity was performed and an adaptation of anammox bacteria after long-term operation at low temperatures](https://reader031.vdocumento.com/reader031/viewer/2022012003/60b1c1aaec02137a5f159732/html5/thumbnails/222.jpg)
Annex II. Inorganic elements analysis
199
Table AII.1.1. Continuation.
Element Inoculum Day 423 Nd < 5 < 5 Sm < 5 < 5 Eu < 5 < 5 Gd < 5 < 5 Dy < 5 < 5 Ho < 5 < 5 Er < 5 < 5
Tm < 5 < 5 Yb < 5 < 5 Lu < 5 < 5 Re < 5 < 5 Os < 5 < 5 Ir < 5 < 5 Pt < 5 < 5
Au < 5 < 5 Hg < 5 < 5 Pb < 5 37 Bi < 5 < 5 Th < 5 < 5 U < 5 < 5