universidad autonoma de chiapas facultad de ciencias quimicas extension ocozocoautla

UNIVERSIDAD AUTONOMA DE CHIAPAS

FACULTAD DE CIENCIAS QUIMICASEXTENSION OCOZOCOAUTLA

BIOQUIMICA

COUTIÑO DIANADOMINGUEZ ZULEIMA

PEREZ FLORINDARUIZ VALERIA

LIPASA ENZYMA: 3.1.1.3

Información GeneralUbicación: Páncreas, Boca, Estómago.

Pertenece a la clase Hidrolasa y actúa sobre los enlaces éster

Enzimas [BR: ko01000]

Nombre Sistemático: 3.1.1.33. Hidrolasas

3.1 Actúan sobre los enlaces éster

3.1.1 hidrolasas carboxílicos-éster

3.1.1.3 triacilglicerol lipasa

Varios tipos diferentes de las lipasas se encuentran en el cuerpo humano (Tabla 1 y 2).

Tabla 1. Tipos de lipasas presentes en el Homo Sapiens

Tipos de Enzima Ubicación Función

Sales biliares lipasa Glándulas mamarias Ayuda a la digestión de grasas

Lipasa Pancreática Páncreas descompone los triglicéridos

Lipasa Lisosomal Orgánulos

Lipasa Hepática endotelio modula el metabolismo de lipoproteínas y la aterosclerosis

Tabla 1. Distribución de los tipos de enzima localizadas en el cuerpo humano. Fuente: (Hanz,2014)

Tabla 2. Homólogos de la lipasa en el Homo Sapiens. Fuente (Kegg, 2014)

Estructura

Fig. 1. Estructura de la lipasa. a) Frontal, b) derecho (PDB, 2014)

a) b)

Fig. 2-Estructura de la lipasa pancreática. a)Estructura del complejo de lipasa-colipasa (3.04 A), b)Interface de la activación lipasa-procolipasa, complejo de dos mezclas, reflejado por cristalografía de rayos X (3.04 A) (GenomaNet, 2014).

a)b)

Fig. 1-subunidades LIPI de humanos (Holmes & Cox, 2012).

Secuencia Proteíca de la enzima Lipasa pancreática en: Homo Sapiens. AA:465, PM:45238 (KEGG, 2014)

MLPLWTLSLLLGAVAGKEVCYERLGCFSDDSPWSGITERPLHILPWSPKDVNTRFLLYTNENPNNFQEVAADSSSISGSNFKTNRKTRFIIHGFIDKGEENWLANVCKNLFKVESVNCICVDWKGGSRTGYTQASQNIRIVGAEVAYFVEFLQSAFGYSPSNVHVIGHSLGAHAAGEAGRRTNGTIGRITGLDPAEPCFQGTPELVRLDPSDAKFVDVIHTDGAPIVPNLGFGMSQVVGHLDFFPNGGVEMPGCKKNILSQIVDIDGIWEGTRDFAACNHLRSYKYYTDSIVNPDGFAGFPCASYNVFTANKCFPCPSGGCPQMGHYADRYPGKTNDVGQKFYLDTGDASNFARWRYKVSVTLSGKKVTGHILVSLFGNKGNSKQYEIFKGTLKPDSTHSNEFDSDVDVGDLQMVKFIWYNNVINPTLPRVGASKIIVETNVGKQFNFCSPETVREEVLLTLTPC

atgctgccactttggactctttcactgctgctgggagcagtagcaggaaaagaagtttgctacgaaagactcggctgcttcagtgatgactccccatggtcaggaattacggaaagacccctccatatattgccttggtctccaaaagatgtcaacacccgcttcctcctatatactaatgagaacccaaacaactttcaagaagttgccgcagattcatcaagcatcagtggctccaatttcaaaacaaatagaaaaactcgctttattattcatggattcatagacaagggagaagaaaactggctggccaatgtgtgcaagaatctgttcaaggtggaaagtgtgaactgtatctgtgtggactggaaaggtggctcccgaactggatacacacaagcctcgcagaacatcaggatcgtgggagcagaagtggcatattttgttgaatttcttcagtcggcgttcggttactcaccttccaacgtgcatgtcattggccacagcctgggtgcccacgctgctggggaggctggaaggagaaccaatgggaccattggacgcatcacagggttggacccagcagaaccttgctttcagggcacacctgaattagtccgattggaccccagcgatgccaaatttgtggatgtaattcacacggatggtgcccccatagtccccaatttggggtttggaatgagccaagtcgtgggccacctagatttctttccaaatggaggagtggaaatgcctggatgtaaaaagaacattctctctcagattgtggacatagacggaatctgggaagggactcgagactttgcggcctgtaatcacttaagaagctacaaatattacactgatagcatcgtcaaccctgatggctttgctggattcccctgtgcctcttacaacgtcttcactgcaaacaagtgtttcccttgtccaagtggaggctgcccacagatgggtcactatgctgatagatatcctgggaaaacaaatgatgtgggccagaaattttatctagacactggtgatgccagtaattttgcacgttggaggtataaggtatctgtcacactgtctggaaaaaaggttacaggacacatactagtttctttgttcggaaataaaggaaactctaagcagtatgaaattttcaagggcactctcaaaccagatagtactcattccaatgaatttgactcagatgtggatgttggggacttgcagatggttaaatttatttggtataacaatgtgatcaacccaactttacctagagtgggagcatccaagattatagtggagacaaatgttggaaaacagttcaacttctgtagtccagaaaccgtcagggaggaagttctgctcaccctcacaccgtgttag

Secuencia Genómica de la enzima Lipasa Pancreática en: Homo Sapiens (KEGG, 2014)

Secuencia genómica

Sitio activo de la lipasa• El sitio activo de la lipasa pancreática se localiza en la triada:

• Ser-152• His-263• Asp-176

•Vista de arriba de la lipas de Mucor miehei

•En rojo zonas polares y en azul zonas hidrofóbicas

•En amarillo sitio activo (UNAM, 2014)

C) estructura cerrada D)estructura abierta

Acceso al sitio catalítico de las lipasas

CofactorLa actividad enzimática de la lipasa pancreática aumenta en gran medida cuando ésta forma un complejo con la colipasa pancreática, una proteína que forma un complejo con la lipasa (Fig. 3).

Fig. 3- Mecanismo de activación de interfaz de la triacilglicerol lipasa en complejo con la procolipasa (Voet & Voet,2006).

Productos• Triacilglicerol

• agua

• Diacilglicerol

• Carboxilato

Sustratos

Reacción

𝑡𝑟𝑖𝑎𝑐𝑖𝑙𝑔𝑙𝑖𝑐𝑒𝑟𝑜𝑙+𝑎𝑔𝑢𝑎↔𝑑𝑖𝑎𝑐𝑖𝑙𝑔𝑙𝑖𝑐𝑒𝑟𝑜𝑙+𝑐𝑎𝑟𝑏𝑜𝑥𝑖𝑙𝑎𝑡𝑜

inhibidor Orlistat Sales Biliares Taurodesoxicolato sodio

pH y To Optima En el Ser Humano:pH optimo: 6.5-7.5To Optima: 37° C

Mecanismo de Reaccion(Orlistat)

Debido a su semejanza estructural con el triglicérido (Fig. 4) el fármaco se acopla al lugar activo de las enzimas mediante un enlace covalente con la serina.La fijación es reversible en condiciones fisiológica, el efecto inhibidor es inalterable durante el recorrido por el tubo digestivo (Fig. 5).

Figura. 4. Estructura molécular del Orlistat (Brenda, 2014).

Figura 5. Mecanismo de acción del Orlistast (Xenical) en las lipasas gástricas y pancreáticas (Londoño, 2012).

REFERENCIAStypes of lipasee. (2014). Recuperado el 31 de agosto de 2014, de types of lipase : http://www.ehow.com/about_5750761_types-lipases.htmlBRENDA. (2014). BRENDA. Recuperado el 31 de agosto de 2014, de The Comprehensive Enzyme Information System: http://www.brenda-enzymes.org/php/result_flat.php4?ecno=3.1.1.3Genomenet. (19 de agosto de 1994). PDB. Recuperado el 31 de agosto de 2014, de pdb: http://www.genome.jp/dbget-bin/www_bget?pdb:1LPAHomo sapiens (Human). (2014). PDB. Recuperado el 31 de agosto de 2014, de PDB: http://www.genome.jp/dbget-bin/pdb_list.cgi?hsa:5406National Library of Medicine. (2012). National Library of Medicine. Recuperado el 01 de agosto de 2014, de Medical Subject Headings: http://www.nlm.nih.gov/cgi/mesh/2012/MB_cgi?mode=&term=ColipasesPDB. (26 de agosto de 20114). RP2 LIPASA. Recuperado el 31 de agosto de 2014, de RP2 LIPASA: http://www.rcsb.org/pdb/explore/jmol.do?structureId=1GPL&bionumber=1Revista Colombiana de Ciencias Químico - Farmacéuticas. (diciembre de 2012). Revista Colombiana de Ciencias Químico - Farmacéuticas. Recuperado el 31 de 09 de 2014, de ratamiento farmacológico contra la obesidad: http://www.scielo.org.co/scielo.php?script=sci_arttext&pid=S0034-74182012000200007UNAM. (2014). Intituto de Biotecnologia. Recuperado el 31 de agosto de 2014, de Intituto de Biotecnologia: http://www.ibt.unam.mx/Voet, & Voet. (2006). Bioquimica. España: Panamericana.

Maltasa ENZYMA: 3.2.1.20

Es la enzima que cataliza la hidrólisis de la maltosa en glucosa La hidrólisis del terminal, no reductor (de 1> 4) residuos de alfa-D--glucosa con liberación de D-glucosa

Enzymes [BR:ko01000] 3. Hidrolasas3.2 Glicosilasas3.2.1 Glicosidasas, enzimas que hidrolizan O- and S-componentes glicosilados 3.2.1.20 alfa glucosidasa

http://www.genome.jp/kegg-bin/search_brite?option=-a&search_string=3.2.1.20

Enzima Producido en Sitio de liberación

Digestión de los carbohidratos

Maltasa Intestino delgado Intestino delgado

Tipos de maltasa• Alfa glucosidasa• Maltasa glucosidasa• Alfa glucosidasa lisosomal• Neutral alfa glucosidasa C

http://www.genome.jp/dbget-bin/www_bget?ec:3.2.1.20

Estructura

Secuencia genetica

209852 MW

1857 AA.

209852 MW

1857 AA.

209852 MW

1857 AA.

secuencia proteica

209852 MW

1857 AA.

Sitio activo

http://www.uniprot.org/blast/?about=P10253[518]

• 529

1857 AA.

209852 MW

• 532

1857 AA.

209852 MW

• 1420

1857 AA.

209852 MW

1423

1857 AA.

209852 MW

• 1426

1857 AA.

http://www.genome.jp/dbget-bin/www_bget?hsa:8972

Funcion del grupo prosterico

Temperatura y pH optimo

TEMPERATURE OPTIMUM

TEMPERATURE OPTIMUM MAXIMUM

ORGANISM UNIPROT ACCESSION NO.

COMMENTARY

25 - Homo sapiens - -37 - Homo sapiens - assay at

additional information

- Homo sapiens - assay at room temperature

http://www.brenda-enzymes.org/php/result_flat.php4?ecno=3.2.1.20&Suchword=&organism%5B%5D=Homo+sapiens&show_tm=0

pH OPTIMUM

pH MAXIMUM ORGANISM COMMENTARY

3.8 - Homo sapiens acid alpha-glucosidase assay at

4 4.5 Homo sapiens hydrolysis of glycogen

4 5.5 Homo sapiens 4-methylumbelliferyl-alpha-glucoside

4 - Homo sapiens hydrolysis of glycogen or maltose, recombinant enzyme

4 - Homo sapiens assay at

4.5 5 Homo sapiens hydrolysis of 4-methylumbelliferyl alpha-glucoside

4.5 - Homo sapiens hydrolysis of maltose

4.6 - Homo sapiens -

5 - Homo sapiens -

5.6 - Homo sapiens hydrolysis of maltotriitol and potato starch

6.5 7.5 Homo sapiens -

6.8 - Homo sapiens assay at

7 - Homo sapiens neutral alpha-glucosidase assay at

7.5 - Homo sapiens 4-methylumbelliferyl-alpha-glucoside

http://www.brenda-enzymes.org/php/result_flat.php4?ecno=3.2.1.20&Suchword=&organism%5B%5D=Homo+sapiens&show_tm=0

Funcion sustrato /producto

SUBSTRATO PRODUCTO                      

1,4-alpha-D-glucooligosaccharide + H2O

alpha-D-glucosa

SUBSTRATE PRODUCT                       REACTION DIAGRAM

4-methylumbelliferyl alpha-D-glucopyranoside + H2O

4-methylumbelliferone + alpha-D-glucopyranose

Sustrato/productoSUBSTRATE PRODUCT                       ORGANISM

1,4-alpha-D-glucooligosaccharide + H2O alpha-D-glucose Homo sapiens

4-methylumbelliferyl alpha-D-glucopyranoside + H2O 4-methylumbelliferone + alpha-D-glucopyranose Homo sapiens

4-methylumbelliferyl-alpha-D-glucopyranoside + H2O 4-methylumbelliferone + alpha-D-glucose Homo sapiens

4-methylumbelliferyl-alpha-D-glucopyranoside + H2O 4-methylumbelliferone + alpha-D-glucose Homo sapiens

4-methylumbelliferyl-alpha-D-glucopyranoside + H2O 4-methylumbelliferol + alpha-D-glucose Homo sapiens

4-methylumbelliferyl-alpha-glucoside + H2O 4-methylumbelliferone + alpha-D-glucose Homo sapiens

4-methylumbelliferyl-alpha-glucoside + H2O 4-methylumbelliferone + alpha-D-glucose Homo sapiens

4-methylumbelliferyl-alpha-glucoside + H2O 4-methylumbelliferone + alpha-D-glucose Homo sapiens

4-nitrophenyl 2-deoxy-alpha-D-glucopyranoside + H2O 4-nitrophenol + 2-deoxy-alpha-D-glucose Homo sapiens

dextrin + H2O alpha-D-glucose + ? Homo sapiens

glycogen + H2O alpha-D-glucose Homo sapiens

glycogen + H2O alpha-D-glucose Homo sapiens

maltopentaose + H2O alpha-D-glucose Homo sapiens

maltose + H2O D-glucose Homo sapiens

maltose + H2O alpha-D-glucose Homo sapiens

maltose + H2O alpha-D-glucose Homo sapiens

maltotetraose + H2O alpha-D-glucose Homo sapiens

maltotriitol + H2O ? Homo sapiens

p-nitrophenyl-alpha-D-glucopyranoside + H2O p-nitrophenol + alpha-D-glucose Homo sapiens

p-nitrophenyl-alpha-D-glucopyranoside + H2O 4-nitrophenol + D-glucose Homo sapiens

palatinose + H2O alpha-D-glucose + D-fructose Homo sapiens

resorufin alpha-D-glucopyranoside + H2O ? Homo sapiens

starch + H2O alpha-D-glucose Homo sapiens

starch + H2O alpha-D-glucose Homo sapiens

starch + H2O alpha-D-glucose Homo sapiens

maltotriose + H2O alpha-maltose + ? Homo sapiens

http://www.brenda-enzymes.org/php/result_flat.php4?ecno=3.2.1.20&Suchword=&organism%5B%5D=Homo+sapiens&show_tm=0

Inhibidores INHIBITORS ORGANISM

(2R,3S,4S)-1-[(2S,3S)-2,4-dihydroxy-3-(tridecyloxy)butyl]-3,4-dihydroxy-2-(hydroxymethyl)tetrahydrothiophenium

Homo sapiens

http://www.brenda-enzymes.org/Mol/Mol.php4?n=318187

Inhibidores INHIBITORS ORGANISM COMMENTARY(2R,3S,4S)-1-[(2S,3S)-2,4-dihydroxy-3-(tridecyloxy)butyl]-3,4-dihydroxy-2-(hydroxymethyl)tetrahydrothiophenium

Homo sapiens -

(2R,3S,4S)-1-[(2S,3S)-2,4-dihydroxy-3-methoxybutyl]-3,4-dihydroxy-2-(hydroxymethyl)tetrahydrothiophenium

Homo sapiens -

(2R,3S,4S)-1-[(2S,3S)-3-(benzyloxy)-2,4-dihydroxybutyl]-3,4-dihydroxy-2-(hydroxymethyl)tetrahydrothiophenium

Homo sapiens -

(2R,3S,4S)-1-[(2S,3S)-3-ethoxy-2,4-dihydroxybutyl]-3,4-dihydroxy-2-(hydroxymethyl)tetrahydrothiophenium

Homo sapiens -

1-deoxynojirimycin Homo sapiens competitive inhibition, binds strongly to the enzyme3'-(3-methylbut-2-enyl)-3',4',7-trihydroxyflavane Homo sapiens -3'-O-methylponkoranol Homo sapiens inhibits the different subunits to different extents, with

extraordinary selectivity for C-terminal subunit of the enzyme

3,4-dihydroxyisolonchocarpin Homo sapiens noncompetitive inhibition4-hydroxyisolonchocarpin Homo sapiens noncompetitive inhibition8-(1,1-dimethylallyl)-5'-(3-methylbut-2-enyl)-3',4',5,7-tetrahydroxyflanvonol

Homo sapiens -

acarbose Homo sapiens bound to the active site primarily through side-chain interactions with its acarvosine unit, almost no interactions with its glycone rings, binding structure, overview

acarbose Homo sapiens -blintol Homo sapiens ; selenium analogue of salacinolBrossoflurenone A Homo sapiens -Brossoflurenone B Homo sapiens -Broussochalcone A Homo sapiens noncompetitive inhibitionBroussochalcone B Homo sapiens noncompetitive inhibitionconduritol B epoxide Homo sapiens active-site directed inhibitorD-glucono-delta-lactone Homo sapiens -

http://www.brenda-enzymes.org/php/result_flat.php4?ecno=3.2.1.20&Suchword=&organism%5B%5D=Homo+sapiens&show_tm=0

de-O-sulfonated kotalanol Homo sapiens - ; isolated from Salacia reticulatade-O-sulfonated kotalanol Homo sapiens - -de-O-sulfonated ponkoranol Homo sapiens - no inhbition of N-terminal subunit N2de-O-sulfonated salacinol Homo sapiens - -glycogen Homo sapiens - competitive inhibition of hydrolysis of 4-

methylumbelliferyl-alpha-D-glucopyranoside, non-competitive inhibition of hydrolysis of maltose

Hg2+ Homo sapiens - HgCl2Hg2+ Homo sapiens - -Kazinol A Homo sapiens - -Kazinol B Homo sapiens - -Kazinol E Homo sapiens - -kotalanol Homo sapiens - ; isolated from Salacia reticulatakotalanol Homo sapiens - -maltose Homo sapiens - hydrolysis of 4-methylumbelliferyl-alpha-glucosidemaltose Homo sapiens - -maltotriose Homo sapiens - exhibits strong substrate inhibition; strong substrate

inhibitionmethyl-alpha-D-glucopyranoside Homo sapiens - no inhibition of maltose hydrolysis, competitive

inhibition of glycogen hydrolysismiglitol Homo sapiens - -N-butyl-deoxynojirimycin Homo sapiens P10253 competitive inhibitionN-butyldeoxynojirimycin Homo sapiens - -N-ethyl-deoxynojirimycin Homo sapiens P10253 competitive inhibitionN-methyl-deoxynojirimycin Homo sapiens P10253 competitive inhibitionNEM Homo sapiens - 2 mM, 70% inhibitionNojirimycin Homo sapiens - -Papyriflavonol A Homo sapiens - -PCMB Homo sapiens - -salacinol Homo sapiens - ; isolated from Salacia reticulatasalacinol Homo sapiens - -Sucrose Homo sapiens - no inhibition of maltose hydrolysis, competitive

inhibition of glycogen hydrolysistrehalose Homo sapiens - no inhibition of maltose hydrolysis, competitive

inhibition of glycogen hydrolysisTris Homo sapiens - -turanose Homo sapiens - -Zn2+ Homo sapiens - -Mn2+ Homo sapiens - -

http://www.brenda-enzymes.org/php/result_flat.php4?ecno=3.2.1.20&Suchword=&organism%5B%5D=Homo+sapiens&show_tm=0

Cofactor • No tiene

http://www.brenda-enzymes.org/php/result_flat.php4?ecno=3.2.1.20&Suchword=&organism%5B%5D=Homo+sapiens&show_tm=0

Usos de la maltasa• 1.Puede servir como un mecanismo de suplemento y apoyo

para el malestar digestivo de los niños autistas • 2. Puede servir como un mecanismo de prevención y apoyo

para la diarrea crónica • 3. Prevención del malestar digestivo asociado con trastornos

digestivos congénitos

Referencias• BRENDA. (2014). BRENDA. Obtenido de The Comprehensive

Enzyme Information System: http://www.brenda-enzymes.org/php/result_flat.php4?ecno=3.2.1.20&Suchword=&organism%5B%5D=Homo+sapiens&show_tm=0

• Group, E. (15 de Agosto de 2011). Global Healing Center. Obtenido de Global Healing Center: http://www.globalhealingcenter.net/salud-natural/maltasa.html

• KEGG. (2014). Kyoto Encyclopedia of Genes and Genomes. Obtenido de Kyoto Encyclopedia of Genes and Genomes: http://www.genome.jp/dbget-bin/www_bget?ec:3.2.1.20