alineamientos simple y mÚltiple juan josé nieto lunes, 11 de julio de 2005
TRANSCRIPT
![Page 1: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/1.jpg)
ALINEAMIENTOS ALINEAMIENTOS SIMPLE Y MÚLTIPLESIMPLE Y MÚLTIPLE
Juan José Nieto
Lunes, 11 de Julio de 2005
![Page 2: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/2.jpg)
ALINEAMIENTO SIMPLEALINEAMIENTO SIMPLE
Consiste en establecer un segmento entre dos secuencias biológicas donde
el número de coincidencias sea máximo
![Page 3: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/3.jpg)
INDELSINDELS
Inserción: INSERT Se asigna una base demasiado pronto
Eliminación: DELETEDQueda sin asignar una base
Se introduce una nueva letra en el alfabeto DNA: El “hueco” (gap) -
![Page 4: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/4.jpg)
ComparaciónComparación
Secuencia 1: M A R I ASecuencia 2: M I R I A MSecuencia 3: M A R I OSecuencia 4: A R I A D N A
![Page 5: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/5.jpg)
ComparaciónComparación
Secuencia 1: MM A R I AR I ASecuencia 2: MM I R I AR I A M
4 coincidencias
![Page 6: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/6.jpg)
ComparaciónComparación
Secuencia 1: MM AA R I R I ASecuencia 3: MM AA R I R I O
3 coincidencias
![Page 7: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/7.jpg)
ComparaciónComparación
Secuencia 1: M A R I ASecuencia 4: A R I A D N A
0 Coincidencias
![Page 8: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/8.jpg)
ComparaciónComparación
Secuencia 1: M A R I AA R I ASecuencia 4: - A R I AA R I A D N A
4 Coincidencias
![Page 9: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/9.jpg)
ComparaciónComparación
Secuencia 5: J O S E
Secuencia 6: P E P E
![Page 10: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/10.jpg)
ComparaciónComparación
Secuencia 5: J O S EE
Secuencia 6: P E P E E
1 coincidencia
![Page 11: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/11.jpg)
Comparación DNA - Comparación DNA - Leucina
Secuencia : T T T A
Secuencia : C T T G
1 coincidencia
![Page 12: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/12.jpg)
ALINEAMIENTOALINEAMIENTO
SIMILITUD
Cuantitativo
HOMOLOGÍA
Cualitativo
![Page 13: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/13.jpg)
Clasificación Clasificación
AlineamientosAlineamientos
![Page 14: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/14.jpg)
Por número de secuenciasPor número de secuencias
Simple
Múltiple
![Page 15: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/15.jpg)
Por nivel de análisisPor nivel de análisis
Global
Local
![Page 16: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/16.jpg)
ProgramasProgramas
BLAST (Basic Local Alignment Search
Tool) http://www.ncbi.nlm.nih.gov
FASTA http://www.ebi.ac.uk
![Page 17: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/17.jpg)
BLASTBLAST
blastp blastn blastx tblastn tblastx
![Page 18: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/18.jpg)
EjemploEjemplo
g c t g a a c g
c t a t a a t c
![Page 19: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/19.jpg)
2 coincidencias2 coincidencias
g c t g a a c g
c t a t a a t c
![Page 20: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/20.jpg)
Otro alineamiento (Muy malo)Otro alineamiento (Muy malo)
- - - - - - - - g c t g a a c g
c t a t a a t c - - - - - - - -
![Page 21: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/21.jpg)
Otro alineamientoOtro alineamiento(1 coincidencia)(1 coincidencia)
- - - - g c t g a a c g
c t a t a a t c - - - -
![Page 22: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/22.jpg)
Otro alineamiento (malo)Otro alineamiento (malo)
g c t g a - a - - c g
- - c t - a t a a t c
![Page 23: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/23.jpg)
Otro alineamiento (bueno)Otro alineamiento (bueno)5 coincidencias
g c t g - a a - c g
- c t a t a a t c -
![Page 24: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/24.jpg)
¿Cuántos alineamientos ¿Cuántos alineamientos posibles hay?posibles hay?
Problema combinatorio
No se permite alinear dos huecos
Hay un número finito de alineamientos
![Page 25: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/25.jpg)
Número de alineamientosNúmero de alineamientos
Primera secuencia: 8 letras
Segunda secuencia: 8 letras
Hay 265 729 alineamientos posibles
![Page 26: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/26.jpg)
¿Cómo elegir el mejor ¿Cómo elegir el mejor alineamiento? alineamiento?
Hay que dar un valor a cada alineamientoElegiremos el (los) que tengan mayor
puntuación.
Por ej.: Coincidencia +1 puntos
No coincidencia 0 puntos
Nos da el número de coincidenciasnúmero de coincidencias
![Page 27: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/27.jpg)
Otra puntuaciónOtra puntuación
Por ej.: Coincidencia +2 puntos
No coincidencia -1 punto
![Page 28: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/28.jpg)
2 coincidencias2 coincidenciasPuntuación: -2 puntosPuntuación: -2 puntos
g c t g a a c g
c t a t a a t c
![Page 29: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/29.jpg)
Otro alineamientoOtro alineamiento-10 puntos-10 puntos
- - - - g c t g a a c g
c t a t a a t c - - - -
![Page 30: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/30.jpg)
Otro alineamientoOtro alineamiento- 11 puntos- 11 puntos
g c t g a - a - - c g
- - c t - a t a a t c
![Page 31: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/31.jpg)
Otro alineamientoOtro alineamiento5 puntos5 puntos
g c t g - a a - c g
- c t a t a a t c -
![Page 32: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/32.jpg)
Algoritmo (teórico)Algoritmo (teórico)
Paso 1 : Considerar todos los alineamientos posibles
Paso 2 :Determinar un valor para ese alineamiento
Paso 3 :Guardar el valor máximo
![Page 33: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/33.jpg)
ProblemaProblema
El número de operaciones crece e una forma “exagerada”
![Page 34: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/34.jpg)
Número de alineamientos de Número de alineamientos de dos secuencias de longituddos secuencias de longitud
n ,mn ,m
n = m = 8 265 729 alineamientos
n = m = 10 8 097 453 alineamientos
![Page 35: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/35.jpg)
Fórmula del número de Fórmula del número de alineamientos posibles alineamientos posibles para dos secuencias de para dos secuencias de
longitud n y m:longitud n y m:
f(n,m)f(n,m)
![Page 36: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/36.jpg)
Fórmula de recurrenciaFórmula de recurrencia
f(n+1 , m+1) = f(n,m+1) + f(n+1,m)
+ f(n,m)
![Page 37: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/37.jpg)
DemostraciónDemostración
Se basa en que el final de un alineamiento es: (- , letra) , (letra , - ) ó (letra , letra)
A. Torres, A. Cabada, J.J. Nieto “An exact formula for the number of alignments between two DNA sequences” DNA SEQUENCE (2003)
![Page 38: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/38.jpg)
ConsecuenciasConsecuencias
f(n+1,n+1) > 3n
f (107 , 107 ) > 1080
Una secuencia “pequeña” tiene 200-500 nucleótidos
Una proteína sobre 200-400 aminoácidos
![Page 39: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/39.jpg)
Alineamiento global:Alineamiento global:Algoritmo de Algoritmo de
Neddleman&Wunsch (1970)Neddleman&Wunsch (1970)
![Page 40: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/40.jpg)
EjemploEjemplo
g c t g a a c g
c t a t a a t c
![Page 41: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/41.jpg)
g c t g a a c g
c 1 1
t 1
a 1 1
t 1
a 1 1
a 1 1
t 1
c 1 1
![Page 42: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/42.jpg)
¿Cómo se puede determinar ¿Cómo se puede determinar el alineamiento óptimo?el alineamiento óptimo?
Aunque no tengamos ni idea, sabemos una cosa: El alineamiento tiene que tener una de las tres terminaciones siguientes
g - g - c c
![Page 43: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/43.jpg)
g c t g a a c g
c 1 1
t 1
a 1 1
t 1
a 1 1
a 1 1
t 1
c 1 1
![Page 44: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/44.jpg)
TerminaciónTerminación
c g c -
![Page 45: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/45.jpg)
g c t g a a c g
c 1 1
t 1
a 1 1
t 1
a 1 1
a 1 1
t 1
c 1 1
![Page 46: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/46.jpg)
g c t g a a
c 1
t 1
a 1 1
t 1
a 1 1
a 1 1
t 1
![Page 47: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/47.jpg)
Simplificación del problema Simplificación del problema originaloriginal
Secuencia 1: g c t g a a Longitud 6
Secuencia 2: c t a t a a t Longitud 7
![Page 48: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/48.jpg)
Posibles terminacionesPosibles terminaciones
a - a - t t
![Page 49: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/49.jpg)
g c t g a a
c 1
t 1
a 1 1
t 1
a 1 1
a 1 1
t 1
![Page 50: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/50.jpg)
TerminaciónTerminación
a - a t
![Page 51: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/51.jpg)
g c t g a a
c 1
t 1
a 1 1
t 1
a 1 1
a 1 1
t 1
![Page 52: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/52.jpg)
4 últimas posiciones del 4 últimas posiciones del alineamientoalineamiento
a - c g a t c -
![Page 53: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/53.jpg)
g c t g a c 1 t 1 a 1 t 1 a 1
![Page 54: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/54.jpg)
g c t g a c 1 t 1 a 1 t 1 a 1
![Page 55: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/55.jpg)
Posibles terminacionesPosibles terminaciones
a - a - a a
![Page 56: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/56.jpg)
5 últimas posiciones del 5 últimas posiciones del alineamientoalineamiento
a a - c g a a t c -
![Page 57: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/57.jpg)
g c t g
c 1
t 1
a
t 1
![Page 58: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/58.jpg)
g c t g
c 1
t 1
a
t 1
![Page 59: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/59.jpg)
Posibles terminacionesPosibles terminaciones
g - g - t t
![Page 60: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/60.jpg)
Terminación correspondiente Terminación correspondiente a la última submatriza la última submatriz
t g t -
![Page 61: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/61.jpg)
g c t g
c 1
t 1
a
t 1
![Page 62: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/62.jpg)
7 últimas posiciones del 7 últimas posiciones del alineamientoalineamiento
t g a a - c g t - a a t c -
![Page 63: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/63.jpg)
g c
c 1
t
a
![Page 64: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/64.jpg)
g c
c 1
t
a
![Page 65: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/65.jpg)
Posibles terminacionesPosibles terminaciones
c - c - a a
![Page 66: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/66.jpg)
Terminación correspondiente Terminación correspondiente a la última submatriza la última submatriz
g c - - - c t a
![Page 67: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/67.jpg)
Alineamiento FinalAlineamiento Final5 coincidencias5 coincidencias
g c - - t g a a - c g - c t a t - a a t c -
![Page 68: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/68.jpg)
Alineamiento FinalAlineamiento Final5 coincidencias5 coincidencias
g c - - t g a a - c g - c t a t - a a t c -
![Page 69: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/69.jpg)
Observación importanteObservación importante
Hemos valorado positivamente las coincidencias, pero no hemos penalizado la introducción de huecos ni las no coincidencias
![Page 70: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/70.jpg)
Alineamiento globalAlineamiento globalPROGRAMACIÓN DINÁMICAPROGRAMACIÓN DINÁMICA
1.- Función de similitud2.- Los indels se penalizan con un peso3.- Se construye una matriz4.- Se recupera la solución
![Page 71: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/71.jpg)
Programación DinámicaProgramación Dinámica
1.- Coincidencia: +1No coincidencia: 0
2.- Introducción de “huecos”: 0
![Page 72: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/72.jpg)
EjemploEjemploProgramación dinámicaProgramación dinámica
g g a t c g a
g a a t t c a g t t a
![Page 73: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/73.jpg)
g g a t c g a
g
a
a
t
t
c
a
g
t
t
a
![Page 74: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/74.jpg)
g g a t c g a
0 0 0 0 0 0 0 0
g 0
a 0
a 0
t 0
t 0
c 0
a 0
g 0
t 0
t 0
a 0
![Page 75: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/75.jpg)
g g a t c g a
0 0 0 0 0 0 0 0
g 0
a 0
a 0
t 0
t 0
c 0
a 0
g 0
t 0
t 0
a 0
![Page 76: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/76.jpg)
Cálculo de los elementos de Cálculo de los elementos de la matrizla matriz
H(i-1,j-1) H(i,j-1)
H(i-1,j) H(i,j)
![Page 77: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/77.jpg)
Entradas matrizEntradas matriz
H(i,j) es el máximo entre:
H(i-1,j-1)+c(xi,yi)
H(i-1,j)-w H(i,j-1)-w
![Page 78: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/78.jpg)
g g a t c g a
0 0 0 0 0 0 0 0
g 0
a 0
a 0
t 0
t 0
c 0
a 0
g 0
t 0
t 0
a 0
![Page 79: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/79.jpg)
g g a t c g a
0 0 0 0 0 0 0 0
g 0 1
a 0
a 0
t 0
t 0
c 0
a 0
g 0
t 0
t 0
a 0
![Page 80: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/80.jpg)
g g a t c g a
0 0 0 0 0 0 0 0
g 0 1 1 1 1 1 1 1
a 0 1
a 0 1
t 0 1
t 0 1
c 0 1
a 0 1
g 0 1
t 0 1
t 0 1
a 0 1
![Page 81: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/81.jpg)
g g a t c g a
0 0 0 0 0 0 0 0
g 0 1 1 1 1 1 1 1
a 0 1
a 0 1
t 0 1
t 0 1
c 0 1
a 0 1
g 0 1
t 0 1
t 0 1
a 0 1
![Page 82: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/82.jpg)
g g a t c g a
0 0 0 0 0 0 0 0
g 0 1 1 1 1 1 1 1
a 0 1 1
a 0 1
t 0 1
t 0 1
c 0 1
a 0 1
g 0 1
t 0 1
t 0 1
a 0 1
![Page 83: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/83.jpg)
g g a t c g a
0 0 0 0 0 0 0 0
g 0 1 1 1 1 1 1 1
a 0 1 1
a 0 1
t 0 1
t 0 1
c 0 1
a 0 1
g 0 1
t 0 1
t 0 1
a 0 1
![Page 84: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/84.jpg)
g g a t c g a
0 0 0 0 0 0 0 0
g 0 1 1 1 1 1 1 1
a 0 1 1 2
a 0 1
t 0 1
t 0 1
c 0 1
a 0 1
g 0 1
t 0 1
t 0 1
a 0 1
![Page 85: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/85.jpg)
g g a t c g a
0 0 0 0 0 0 0 0
g 0 1 1 1 1 1 1 1
a 0 1 1 2 2 2 2 2
a 0 1 1 2 2 2 2 3
t 0 1 1 2 3 3 3 3
t 0 1 1 2 3 3 3 3
c 0 1 1 2 3 4 4 4
a 0 1 1 2 3 4 4 5
g 0 1 2 2 3 4 5 5
t 0 1 2 2 3 4 5 5
t 0 1 2 2 3 4 5 5
a 0 1 2 3 3 4 5 6
![Page 86: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/86.jpg)
g g a t c g a
0 0 0 0 0 0 0 0
g 0 1 1 1 1 1 1 1
a 0 1 1 2 2 2 2 2
a 0 1 1 2 2 2 2 3
t 0 1 1 2 3 3 3 3
t 0 1 1 2 3 3 3 3
c 0 1 1 2 3 4 4 4
a 0 1 1 2 3 4 4 5
g 0 1 2 2 3 4 5 5
t 0 1 2 2 3 4 5 5
t 0 1 2 2 3 4 5 5
a 0 1 2 3 3 4 5 6
![Page 87: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/87.jpg)
AlineamientoAlineamientoProgramación dinámicaProgramación dinámica
g g a - t - c - g - - a
g - a a t t c a g t t a
![Page 88: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/88.jpg)
AlineamientoAlineamientoProgramación dinámicaProgramación dinámica
6 coincidencias
g g a - t - c - g - - a
g - a a t t c a g t t a
![Page 89: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/89.jpg)
EjemploEjemploProgramación dinámicaProgramación dinámica
g c t g a a c g
c t a t a a t c
![Page 90: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/90.jpg)
c t a t a a t c
0 0 0 0 0 0 0 0 0
g 0
c 0
t 0
g 0
a 0
a 0
c 0
g 0
![Page 91: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/91.jpg)
c t a t a a t c
0 0 0 0 0 0 0 0 0
g 0 0 0 0 0 0 0 0 0
c 0 1 1 1 1 1 1 1 1
t 0 1 2 2 2 2 2 2 2
g 0 1 2 2 2 2 2 2 2
a 0 1 2 3 3 3 3 3 3
a 0 1 2 3 3 4 4 4 3
c 0 1 2 3 3 4 4 4 5
g 0 1 2 3 3 4 4 4 5
![Page 92: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/92.jpg)
c t a t a a t c
0 0 0 0 0 0 0 0 0
g 0 0 0 0 0 0 0 0 0
c 0 1 1 1 1 1 1 1 1
t 0 1 2 2 2 2 2 2 2
g 0 1 2 2 2 2 2 2 2
a 0 1 2 3 3 3 3 3 3
a 0 1 2 3 3 4 4 4 3
c 0 1 2 3 3 4 4 4 5
g 0 1 2 3 3 4 4 4 5
![Page 93: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/93.jpg)
Alineamiento FinalAlineamiento FinalProgramación dinámicaProgramación dinámica
5 coincidencias / 5 puntos5 coincidencias / 5 puntos
- c t a t a a t c - g c t g - a a - c g
![Page 94: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/94.jpg)
c t a t a a t c
0 0 0 0 0 0 0 0 0
g 0 0 0 0 0 0 0 0 0
c 0 1 1 1 1 1 1 1 1
t 0 1 2 2 2 2 2 2 2
g 0 1 2 2 2 2 2 2 2
a 0 1 2 3 3 3 3 3 3
a 0 1 2 3 3 4 4 4 3
c 0 1 2 3 3 4 4 4 5
g 0 1 2 3 3 4 4 4 5
![Page 95: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/95.jpg)
Alineamiento FinalAlineamiento FinalProgramación dinámicaProgramación dinámica
5 coincidencias / 5 puntos5 coincidencias / 5 puntos
- c t - a t a a t c - g c t g a - a - - c g
![Page 96: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/96.jpg)
Programación DinámicaProgramación Dinámica
1.- Coincidencia: +2No coincidencia: -1
2.- Introducción de “huecos”: -1
![Page 97: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/97.jpg)
c t a t a a t c
0 -1 -2 -3 -4 -5 -6 -7 -8
g -1 -1 -2 -3 -4 -5 -6 -7 -8
c -2 1 0 -1 -2 -3 -4 -5 -5
t -3 0 3 2 1 0 -1 -2 -3
g -4 -1 2 2 1 0 -1 -2 -3
a -5 -2 1 4 3 3 2 1 0
a -6 -3 0 3 3 5 5 4 3
c -7 -4 -1 2 2 4 4 4 6
g -8 -5 -2 1 1 3 3 3 5
![Page 98: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/98.jpg)
c t a t a a t c
0 -1 -2 -3 -4 -5 -6 -7 -8
g -1 -1 -2 -3 -4 -5 -6 -7 -8
c -2 1 0 -1 -2 -3 -4 -5 -5
t -3 0 3 2 1 0 -1 -2 -3
g -4 -1 2 2 1 0 -1 -2 -3
a -5 -2 1 4 3 3 2 1 0
a -6 -3 0 3 3 5 5 4 3
c -7 -4 -1 2 2 4 4 4 6
g -8 -5 -2 1 1 3 3 3 5
![Page 99: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/99.jpg)
Alineamiento FinalAlineamiento FinalProgramación dinámicaProgramación dinámica
5 coincidencias / 4 puntos5 coincidencias / 4 puntos
- c t - a t a a t c - g c t g a - a - - c g
![Page 100: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/100.jpg)
M. TuberculosisM. Tuberculosis 1-100 1-100
ttgaccgatgaccccggttcaggcttcaccacagtgtggaacgcggtcgtctccgaacttaacggcgaccctactaaggttgacgacggacccagcagtgatg
![Page 101: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/101.jpg)
http://www.ebi.ac.uk
BlastNBlastN
c t a t
![Page 102: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/102.jpg)
http://www.ebi.ac.uk
BlastNBlastN
c t a t a a t
![Page 103: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/103.jpg)
c t a t a a tc t a t a a t
EMBL:HS216E10 Z83840 Human DNA sequence from clone CTA-216E10 on chromosone 22 ..... 122320
EMBL:CHCRRU573 U57326Chlamudomonas reinhardtii RpoC2 protein ...... 10826
![Page 104: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/104.jpg)
Alineamiento MúltipleAlineamiento Múltiple
![Page 105: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/105.jpg)
Alineamiento MúltipleAlineamiento Múltiple
![Page 106: ALINEAMIENTOS SIMPLE Y MÚLTIPLE Juan José Nieto Lunes, 11 de Julio de 2005](https://reader035.vdocumento.com/reader035/viewer/2022062809/5665b4831a28abb57c922268/html5/thumbnails/106.jpg)
FINFIN