9 3 3 1 13:3 9:7 9:3:4 12:3:1 15:1 A-B- A-bb aaB- 206%20...•Un gen –Alelismo ... •Genética bioquímica:…

Download 9 3 3 1 13:3 9:7 9:3:4 12:3:1 15:1 A-B- A-bb aaB- 206%20...•Un gen –Alelismo ... •Genética bioquímica:…

Post on 21-Oct-2018

212 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

<ul><li><p>1 </p><p>Dr. Antonio Barbadilla </p><p>9 3 3 1 </p><p>13:3 </p><p>9:7 </p><p>9:3:4 </p><p>15:1 </p><p>A-B- A-bb aaB- aabb </p><p>12:3:1 </p><p>Tema 6: Extensiones del anlisis mendeliano 1 </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>2 </p><p>Dr. Antonio Barbadilla </p><p>2 </p><p>Objetivos tema 6 Extensiones del anlisis mendeliano </p><p>Debern quedar bien claros los siguientes puntos Relaciones genotipo-fenotipo </p><p>Un gen Alelismo mltiple Gen esencial y letal La distincin entre dominancia incompleta, parcial y codominancia Pleiotropa Penetrancia y expresividad </p><p>Ms de un gen Caracteres determinados por ms de un gen Interaccin entre genes </p><p>Gentica bioqumica: la hiptesis un gen-una enzima Prueba de complementacin </p><p>Tema 6: Extensiones del anlisis mendeliano </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>3 </p><p>Dr. Antonio Barbadilla </p><p>3 </p><p>Alelismo mltiple Grupos AB0 </p><p>A=B&gt;0 </p><p>Fenotipo Genotipo A- AA A0 B- BB B0 AB AB 0 00 </p><p> Color pelaje conejo </p><p>C+ &gt; Cch &gt; Ch &gt; c </p><p> C+ </p><p> Salvaje </p><p> Cch </p><p> Chinchilla </p><p> Ch Himalaya </p><p> c </p><p> albino </p><p>Tema 6: Extensiones del anlisis mendeliano </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>4 </p><p>Dr. Antonio Barbadilla </p><p>4 </p><p>Alelismo mltiple </p><p>BRCA2 </p><p>Individual 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag </p><p>Individual 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag </p><p>Individual 3 acgtagcatcgtatgcgttagacggcggggtagcaccagtacag </p><p>Individual 4 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag </p><p>Individual 5 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag </p><p>Individual 6 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag </p><p>Individual 7 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag </p><p>Individual 8 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag </p><p>Individual 9 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag </p><p>A nivel de secuencia nucleotdica prcticamente cada copia de un gen es diferente en algn nucletido de su secuencia. El alelismo mltiple es ubicuo. </p><p>Tema 6: Extensiones del anlisis mendeliano </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>6 </p><p>Dr. Antonio Barbadilla </p><p> Indiv1Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag Indiv1Secuencia 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag </p><p>Indiv2Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag Indiv2Secuencia 2 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag </p><p>Indiv3 Secuencia 1 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Indiv3 Secuencia 2 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag </p><p>6 </p><p>Alelo A = a Alelo a = t </p><p>Se usa la notacin AA, Aa y aa para denominar a los genotipos mendelianos que determinan un fenotipo, pero en realidad stos son internamente heterogneos en el nivel de DNA. Su asignacin como genotipo AA aa se debe generalmente a que todas las secuencias que pertenecen al genotipo AA comparten un fenotipo distinto de las que pertenecen al genotipo aa y esta diferencia fenotpica se debe posiblemente a un nucletido (o a unos pocos) que sera el verdadero genotipo que causa los diferentes fenotipos </p><p>Cmo explicamos los genotipos mendelianos si en el nivel del DNA cada alelo </p><p>suele ser distinto? </p><p>Secuencia nucleotdica de una regin del gen A en distintos individuos </p><p>Genotipo AA = aa -&gt; Fenotipo A </p><p>Genotipo Aa = at -&gt; Fenotipo A </p><p>Genotipo aa = at -&gt; Fenotipo a </p><p>Tema 6: Extensiones del anlisis mendeliano </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>7 </p><p>Dr. Antonio Barbadilla </p><p>Tema 8: Extensiones del anlisis mendeliano 7 </p><p>Gen letal y esencial Un gen que cuando est alterado es letal, es un gen esencial </p><p>Gen y del ratn domstico es un ejemplo Alelo y es dominante para el color amarillo, letal en homocigosis. Alteracin proporciones mendelianas de la F2 es 2:1 </p><p>Yy x Yy </p><p>2 Yy : 1 YY </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>8 </p><p>Dr. Antonio Barbadilla </p><p>8 </p><p> Impronta parental </p><p>Ejemplo Factor crecimiento II tipo insulina (Igf2) en ratn y humanos. </p><p>Mutante homocigoto -&gt; enano. El fenotipo del heterocigoto depende del origen del alelo </p><p>Alelo salvaje es paterno -&gt; fenotipo salvaje Alelo salvaje es materno -&gt; fenotipo enano (el gen procedente de la madre no se expresa) </p><p>Edad de aparicin de un fenotipo </p><p>Temprana Tarda </p><p>Aparicin tarda de la enfermedad de Huntington (autosmica dominante) </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>9 </p><p>Dr. Antonio Barbadilla </p><p>9 </p><p>Ausencia de dominancia en el Dondiego de noche (Mirabilis jalapa) </p><p>P1 </p><p>F1 </p><p>F2 </p><p>Relaciones genotipo-fenotipo </p><p>Tema 6: Extensiones del anlisis mendeliano </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>10 </p><p>Dr. Antonio Barbadilla </p><p>10 </p><p>Relacin genotipo-fenotipo: Variacin en la dominancia </p><p>Tema 6: Extensiones del anlisis mendeliano </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>11 </p><p>Dr. Antonio Barbadilla </p><p>11 </p><p>Presencia de ambos fenotipos paternos en el heterocigoto </p><p>Grupo sanguneo AB0 </p><p>Heterocigoto protena detectada por electroforesis en hemoglobina </p><p>Relacin genotipo-fenotipo: Codominancia </p><p>Tema 6: Extensiones del anlisis mendeliano </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>12 </p><p>Dr. Antonio Barbadilla </p><p>12 </p><p>Relacin genotipo-fenotipo: Niveles de dominancia: la dominancia o codominancia no es </p><p>una propiedad del genotipo sino del fenotipo </p><p>HbAHbA: Normal. HbSHbS: Anemia grave. HbAHbS: No anemia </p><p>Tema 6: Extensiones del anlisis mendeliano </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>13 </p><p>Dr. Antonio Barbadilla </p><p>Tema 8: Extensiones del anlisis mendeliano 13 </p><p>Relacin genotipo-fenotipo: Retinoblastoma hereditario </p><p>R &gt; r en el nivel celular pero </p><p>r &gt; R en el nivel del organismo </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>14 </p><p>Dr. Antonio Barbadilla </p><p>14 </p><p>Pleiotropa: un gen -&gt; varios caracteres Ejemplo anemia falciforme </p><p>Distorsin de los glbulos rojos, adquieren forma de hoz (falciforme) </p><p>Produccin de hemoglobina S en lugar de la A </p><p>Cambio de un nucletido en el DNA del gen de </p><p> la hemoglobina </p><p>Problemas circulatorios </p><p>Acumulacin de clulas falciformes en el bazo </p><p>Dao en el bazo </p><p>Rpida destruccin de los glbulos rojos </p><p>Anemia </p><p>Debilidad fsica </p><p>Fallo cardiaco </p><p>Funcin mental disminuida </p><p>Dao cerebral </p><p>Daos en otros rganos </p><p>Parlisis </p><p>Neumona Reumatismo Fallo renal </p><p>Agregacin de la hemoglobina S para formar estructuras casi cristalinas en </p><p>aguja en los glbulos rojos </p><p>Baja concentracin de oxgeno en lo tejidos </p><p>Tema 6: Extensiones del anlisis mendeliano </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>15 </p><p>Dr. Antonio Barbadilla </p><p>15 </p><p>Penetrancia y expresividad Ambos conceptos se refieren a la expresin fenotpica variable de ciertos genes Penetrancia: Proporcin de individuos en una poblacin que presentan el fenotipo correspondiente a su genotipo. Si P &lt; 1 se habla de penetrancia incompleta Expresividad: El grado de expresin individual de un fenotipo para un genotipo dado </p><p>Tema 6: Extensiones del anlisis mendeliano </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>16 </p><p>Dr. Antonio Barbadilla </p><p>16 </p><p>Expresividad </p><p>La polidactilia se manifiesta en grados distintos Tema 6: Extensiones del anlisis mendeliano </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>17 </p><p>Dr. Antonio Barbadilla </p><p>Expresividad </p><p>Tema 8: Extensiones del anlisis mendeliano 17 </p><p>10 grados de expresividad variable en el carcter piel manchada en perros de la raza beagle. </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>18 </p><p>Dr. Antonio Barbadilla </p><p>Tema 6: Extensiones del anlisis mendeliano 18 </p><p>Caracteres determinados por ms de un gen </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>19 </p><p>Dr. Antonio Barbadilla </p><p>Tema 6: Extensiones del anlisis mendeliano 19 </p><p>Caracteres determinados por ms de un gen </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>20 </p><p>Dr. Antonio Barbadilla </p><p>Tema 6: Extensiones del anlisis mendeliano 20 </p><p>Caracteres determinados por ms de un gen: color del fruto pimiento Capsicum annum </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>21 </p><p>Dr. Antonio Barbadilla </p><p>Tema 6: Extensiones del anlisis mendeliano 21 </p><p>Interaccin entre genes: dos o ms genes determinan el fenotipo de un modo que alteran las proporciones mendelianas esperadas </p><p>Variedad blanca 1 Variedad blanca 2 </p><p>Prpura AAbb aaBB </p><p>AaBb x AaBb </p><p>1/4 AB </p><p>1/4 Ab </p><p>1/4 ab </p><p>1/4 aB </p><p>1/4 ab 1/4 aB 1/4 Ab 1/4 AB </p><p>AABB </p><p>AABb </p><p>AaBb </p><p>AaBB </p><p>AAbB </p><p>AAbb </p><p>AaBb </p><p>Aabb </p><p>AaBB </p><p>AabB </p><p>aaBB </p><p>aaBb aabb </p><p>aaBb </p><p>AaBb </p><p>Aabb </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>22 </p><p>Dr. Antonio Barbadilla </p><p>Tema 6: Extensiones del anlisis mendeliano 22 </p><p>Tipos de interaccin gentica segn la modificacin de las proporciones mendelianas </p><p>9 3 3 1 </p><p>13:3 9:7 </p><p>9:3:4 </p><p>15:1 </p><p>A-B- A-bb aaB- aabb </p><p>12:3:1 </p><p>9:3:3:1 </p><p>Epistasia recesiva doble </p><p>Epistasia recesiva </p><p>Epistasia dominante </p><p>Epistasia dominante doble (duplicacin) </p><p>Epistasia dominante y recesiva (supresora) </p><p>Epistasia: enmascaramiento de la expresin de un gen por la accin de otro gen distinto </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>23 </p><p>Dr. Antonio Barbadilla </p><p>Tema 6: Extensiones del anlisis mendeliano 23 </p><p>Gentica bioqumica: estudio de la relacin entre genes y </p><p>enzimas </p><p>Hiptesis un gen - una enzima (Beadle y Tatum 1941) -&gt; Estudio de la ruta biosinttica de la niacina (vitamina B3 en el hongo del pan Neurospora crassa) </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>24 </p><p>Dr. Antonio Barbadilla </p><p>Tema 8: Extensiones del anlisis mendeliano 24 </p><p>Gentica bioqumica: muchos genes cooperan en el producto final </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>25 </p><p>Dr. Antonio Barbadilla </p><p>25 </p><p>Explicacin bioqumica de la proporcin 9:7 en el color de la aleurona del maz </p><p> Precursor Intermediario Producto final blanco blanco prpura </p><p>Enzima A Enzima B </p><p>Gen A Gen B </p><p>Para obtener el producto final prpura necesitamos que tanto el gen A como el B produzcan una enzima funcional. Si uno de los dos genes falla (genotipo aa bb), el producto final ser blanco </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>26 </p><p>Dr. Antonio Barbadilla </p><p>Explicacin bioqumica de la epistasia recesiva 9:3:4 en la sntesis de los pigmentos de los ptalos de la planta Mary ojos azules (Collinsia parviflora) </p><p>26 </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>27 </p><p>Dr. Antonio Barbadilla </p><p>Tema 8: Extensiones del anlisis mendeliano 27 </p><p>Prueba de complementacin: permite saber si dos mutaciones estn en el mismo </p><p>locus o en diferentes loci </p><p>Complementacin: un individuo con dos </p><p>mutaciones fenotpicas presenta un fenotipo salvaje </p><p>Diferentes loci </p><p>Mismo locus </p><p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</p></li><li><p>28 </p><p>Dr. Antonio Barbadilla </p><p>Tema 6: Extensiones del anlisis mendeliano 28 </p><p> Buscad ejemplos de caracteres en los que se dan interacciones genticas que no se han ilustrado en este tema (como por ejemplo la epistasia dominante doble) </p><p> Proponed rutas bioqumicas u otros mecanismos genticos para explicar los tipos de interaccin descritos en los que no se ha presentado un mecanismo </p>http://biologia.uab.es/dgm/cv/barbadilla prados.asp</li></ul>